ID: 1060223112

View in Genome Browser
Species Human (GRCh38)
Location 9:121774734-121774756
Sequence ACCTGGGGGTTGAGGGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060223100_1060223112 16 Left 1060223100 9:121774695-121774717 CCTTAGCCCAGGCAACTGAGGCA 0: 1
1: 0
2: 6
3: 35
4: 312
Right 1060223112 9:121774734-121774756 ACCTGGGGGTTGAGGGCTGAGGG No data
1060223097_1060223112 30 Left 1060223097 9:121774681-121774703 CCTCTGGGAAGGCTCCTTAGCCC 0: 1
1: 0
2: 1
3: 16
4: 175
Right 1060223112 9:121774734-121774756 ACCTGGGGGTTGAGGGCTGAGGG No data
1060223101_1060223112 10 Left 1060223101 9:121774701-121774723 CCCAGGCAACTGAGGCAGTTGAG 0: 1
1: 0
2: 0
3: 34
4: 271
Right 1060223112 9:121774734-121774756 ACCTGGGGGTTGAGGGCTGAGGG No data
1060223102_1060223112 9 Left 1060223102 9:121774702-121774724 CCAGGCAACTGAGGCAGTTGAGC 0: 1
1: 0
2: 1
3: 6
4: 184
Right 1060223112 9:121774734-121774756 ACCTGGGGGTTGAGGGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060223112 Original CRISPR ACCTGGGGGTTGAGGGCTGA GGG Intronic
No off target data available for this crispr