ID: 1060228421

View in Genome Browser
Species Human (GRCh38)
Location 9:121809913-121809935
Sequence GTCGAGCTGAACCCCGGTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060228415_1060228421 -4 Left 1060228415 9:121809894-121809916 CCCCCAAACCAGGTGAGGAGTCG No data
Right 1060228421 9:121809913-121809935 GTCGAGCTGAACCCCGGTGACGG No data
1060228416_1060228421 -5 Left 1060228416 9:121809895-121809917 CCCCAAACCAGGTGAGGAGTCGA No data
Right 1060228421 9:121809913-121809935 GTCGAGCTGAACCCCGGTGACGG No data
1060228417_1060228421 -6 Left 1060228417 9:121809896-121809918 CCCAAACCAGGTGAGGAGTCGAG No data
Right 1060228421 9:121809913-121809935 GTCGAGCTGAACCCCGGTGACGG No data
1060228409_1060228421 13 Left 1060228409 9:121809877-121809899 CCCCAAATGGAAAAGACCCCCCA No data
Right 1060228421 9:121809913-121809935 GTCGAGCTGAACCCCGGTGACGG No data
1060228410_1060228421 12 Left 1060228410 9:121809878-121809900 CCCAAATGGAAAAGACCCCCCAA No data
Right 1060228421 9:121809913-121809935 GTCGAGCTGAACCCCGGTGACGG No data
1060228414_1060228421 -3 Left 1060228414 9:121809893-121809915 CCCCCCAAACCAGGTGAGGAGTC No data
Right 1060228421 9:121809913-121809935 GTCGAGCTGAACCCCGGTGACGG No data
1060228418_1060228421 -7 Left 1060228418 9:121809897-121809919 CCAAACCAGGTGAGGAGTCGAGC No data
Right 1060228421 9:121809913-121809935 GTCGAGCTGAACCCCGGTGACGG No data
1060228411_1060228421 11 Left 1060228411 9:121809879-121809901 CCAAATGGAAAAGACCCCCCAAA No data
Right 1060228421 9:121809913-121809935 GTCGAGCTGAACCCCGGTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060228421 Original CRISPR GTCGAGCTGAACCCCGGTGA CGG Intergenic
No off target data available for this crispr