ID: 1060230440

View in Genome Browser
Species Human (GRCh38)
Location 9:121821663-121821685
Sequence GCTCCCCTGACCCTGGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060230434_1060230440 28 Left 1060230434 9:121821612-121821634 CCTGGGGATACAGATGGAGACAA No data
Right 1060230440 9:121821663-121821685 GCTCCCCTGACCCTGGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060230440 Original CRISPR GCTCCCCTGACCCTGGCACC AGG Intergenic