ID: 1060234102

View in Genome Browser
Species Human (GRCh38)
Location 9:121850293-121850315
Sequence TAGGGTCTCCACTTTAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060234102_1060234108 13 Left 1060234102 9:121850293-121850315 CCATCTTTAAAGTGGAGACCCTA 0: 1
1: 0
2: 0
3: 25
4: 227
Right 1060234108 9:121850329-121850351 GTGGCTCAGTCCAAGTCTGATGG 0: 7
1: 34
2: 87
3: 135
4: 378
1060234102_1060234105 -6 Left 1060234102 9:121850293-121850315 CCATCTTTAAAGTGGAGACCCTA 0: 1
1: 0
2: 0
3: 25
4: 227
Right 1060234105 9:121850310-121850332 ACCCTAGGAAGTCAGTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060234102 Original CRISPR TAGGGTCTCCACTTTAAAGA TGG (reversed) Intronic
902760995 1:18580679-18580701 TAGTTTGTCCACTTTTAAGATGG - Intergenic
904943180 1:34178937-34178959 TAGTGTCCCCATTTTACAGATGG + Intronic
905176077 1:36136157-36136179 TATGGCCTCCACTCTAAAAATGG + Intergenic
907044740 1:51293863-51293885 TGGTGTCTCCATTTTACAGATGG - Intronic
907775674 1:57512045-57512067 TATGTCCTCCATTTTAAAGATGG + Intronic
908725230 1:67168758-67168780 TCGGTTCTCTACTTTAAAGTAGG + Intronic
910320952 1:85943298-85943320 CAGGGTCTCCAGTTTGCAGATGG + Intronic
910677837 1:89832671-89832693 TAGGGACTCTACTCTACAGATGG + Intronic
910710481 1:90174772-90174794 TATCATCTCCACTTTAAAGATGG + Intergenic
911944176 1:104084784-104084806 TAGGGTTTTCACTTTGAACATGG - Intergenic
912495986 1:110091902-110091924 TAGGGTTGCCTCATTAAAGATGG - Intergenic
913249477 1:116900563-116900585 TATTGTCTCCATTTTATAGATGG + Intergenic
913279405 1:117171742-117171764 TATTGTCTCCATTTTATAGATGG + Intronic
916017949 1:160766944-160766966 TAAGATCTCCACTTCAAAGATGG + Intergenic
917530054 1:175826977-175826999 TATGGTGGCCACTTTTAAGATGG - Intergenic
920000046 1:202790821-202790843 CCTGGTCTCCACTTTCAAGATGG - Intronic
920877928 1:209854678-209854700 TAGGGTCTCAAGATTACAGAAGG + Exonic
921512892 1:216053978-216054000 CAGGGTTTCCACTTAACAGAGGG + Intronic
924041031 1:239984021-239984043 AAGGATCTCCAATTAAAAGAAGG - Intergenic
924793760 1:247277256-247277278 CAGAGTCTCCACTAGAAAGAAGG - Intergenic
1063327600 10:5120380-5120402 TAGGGTCTCCACGATCAAGCTGG + Intronic
1064102208 10:12473562-12473584 TATTGTCTCCATTTTACAGATGG + Intronic
1065389709 10:25170108-25170130 TACTGTTTCCACTTTACAGATGG - Intergenic
1065547838 10:26839814-26839836 TAAAGTTTGCACTTTAAAGATGG + Intronic
1065554344 10:26899984-26900006 CTGGGTCTCCACTTGTAAGATGG + Intergenic
1065742276 10:28807822-28807844 TAGGGACCCTTCTTTAAAGAGGG - Intergenic
1067714390 10:48678085-48678107 CAGAGTCTCCACTTTGAGGAAGG - Intergenic
1071057471 10:81528322-81528344 AAGGATCTCCAATTAAAAGAAGG + Intergenic
1071517009 10:86304709-86304731 TACGATCTCCATTTTACAGATGG + Intronic
1074810897 10:117104028-117104050 TATTGTCTCCATTTTATAGATGG + Intronic
1075887012 10:125909018-125909040 TAGGGCATCCAATTTCAAGACGG + Intronic
1078235873 11:9484159-9484181 TAGGTTCTCAACCTTAAATACGG - Intronic
1078461806 11:11520242-11520264 TATTTTCTCCATTTTAAAGATGG + Intronic
1079359762 11:19760600-19760622 TAGGGACTCCATTCTACAGAGGG - Intronic
1079944652 11:26726586-26726608 TAGGGTTTGCAATTTAAATAGGG - Intergenic
1080653375 11:34240186-34240208 TTGGCTTTACACTTTAAAGAGGG - Intronic
1081635574 11:44719336-44719358 TATTGTCTCCATTTTACAGATGG - Intergenic
1082094574 11:48118851-48118873 TAATGTCACCATTTTAAAGAAGG - Intronic
1083309471 11:61777037-61777059 CAGGGTCTCCACAGTAAAGCAGG + Intronic
1084370753 11:68741183-68741205 TATGGCTTCCACTCTAAAGAGGG - Intronic
1086490094 11:87350326-87350348 TAGGGTCTCCAGCTTGCAGACGG + Intergenic
1087076706 11:94132539-94132561 CAGGGGCTCCACATGAAAGAAGG + Intronic
1087195499 11:95300616-95300638 TATTGTCTCCATTTTACAGATGG + Intergenic
1088745328 11:112799932-112799954 TGGGTTCTCCTCTTTAAGGATGG + Intergenic
1089261839 11:117229058-117229080 TACAATCTCCACTTTACAGATGG + Intronic
1091665619 12:2416489-2416511 TACCGTCTCCATTTTATAGAGGG + Intronic
1091926389 12:4354080-4354102 GTGAGTCTCAACTTTAAAGAGGG + Exonic
1094266792 12:28568738-28568760 CAGGGTCTCCATTTTTAAGGAGG - Intronic
1094268966 12:28590223-28590245 TAGGGACCCCACTTTTAGGATGG - Intergenic
1096066817 12:48747521-48747543 TAGGGTCTGCACTATTAAAAAGG - Intergenic
1096406110 12:51345659-51345681 TAGGTTCTCGATTTTAAAGATGG - Intronic
1096468499 12:51862076-51862098 CAGGGTCTCCATTTCACAGATGG - Intergenic
1097369423 12:58758490-58758512 TAGTGTCTAAATTTTAAAGATGG - Intronic
1098744740 12:74221416-74221438 TTGGGGCTCCACTTGAAAGACGG - Intergenic
1101600664 12:106206639-106206661 AAGGGTCTCAACCATAAAGATGG - Intergenic
1102234294 12:111284589-111284611 TAGTGTCACCATTTTACAGAAGG + Intronic
1102429805 12:112874380-112874402 TATGATCTCCATTTTATAGATGG - Intronic
1102544221 12:113642911-113642933 TACTGTCTCCATTTTATAGATGG - Intergenic
1106821323 13:33467769-33467791 TATTATCTCCACTTTATAGATGG + Intergenic
1107142626 13:37018605-37018627 TAGGTCCTCTAATTTAAAGAAGG - Intronic
1107453680 13:40535512-40535534 TAGGGTCTTCATTTTGAAAAGGG - Intergenic
1107801407 13:44111095-44111117 TATTGTGTCCACTTTATAGAGGG + Intergenic
1109142556 13:58733435-58733457 CAGGGTCTCCAGTTTGCAGATGG - Intergenic
1109329993 13:60917850-60917872 TGTGGTCTCCACTTCCAAGATGG + Intergenic
1110472023 13:75870996-75871018 TGGGGTCTTGACTTTAAAAACGG + Intergenic
1113738073 13:112691719-112691741 CAAGGTCTCCTATTTAAAGAAGG - Intronic
1114211240 14:20616988-20617010 TTGGGTCCCCACTTCCAAGATGG - Intergenic
1118694676 14:68372641-68372663 TTATGTCACCACTTTAAAGAGGG + Intronic
1121106318 14:91282142-91282164 CAGGGTCTCCATTTTGGAGATGG + Intronic
1202845757 14_GL000009v2_random:173013-173035 TAGGGGCTCTACTCTCAAGATGG + Intergenic
1202877525 14_KI270722v1_random:19437-19459 TAGGGGCTCCACTCTCAAGATGG - Intergenic
1124440786 15:29685047-29685069 TAGAGTCTCCACTTTCAAAATGG + Intergenic
1125281823 15:38049934-38049956 TAGGGTCCTCATTTTAAAGACGG + Intergenic
1125975227 15:43945174-43945196 TAGGGTCTACCCTTGGAAGAAGG - Intronic
1126088426 15:45030281-45030303 TAGGGTCTCCCCTTAGAATAGGG - Intronic
1126781793 15:52145299-52145321 TTGTGTCTCCACTTTATAGATGG - Intronic
1128235971 15:66067407-66067429 TACTGTTTCCACTTTACAGATGG + Intronic
1131843846 15:96468032-96468054 TGTGGTCTCCATTTTAATGAAGG - Intergenic
1132251201 15:100336847-100336869 TGGGGACCCCACTTTTAAGAGGG - Intronic
1133503260 16:6385648-6385670 TATTGTGTCCATTTTAAAGATGG - Intronic
1133966959 16:10538454-10538476 GGGGGTCTCCATTTTAGAGAGGG + Intronic
1134013310 16:10871140-10871162 TATCATCTCCACTTTATAGATGG - Intergenic
1134693335 16:16205256-16205278 TAGGTTTTCCATTTTACAGAAGG + Intronic
1134978517 16:18589445-18589467 TAGGTTCTCCATTTTACAGAAGG - Intergenic
1135106785 16:19656592-19656614 CATCGTCTCCACTTTACAGATGG - Intronic
1137272148 16:46908893-46908915 GAGAGTCTCCACCTTAAACACGG - Intronic
1137529328 16:49267385-49267407 CAGGGGCTCCATTTTAAACATGG + Intergenic
1137875137 16:51989515-51989537 TTGAGTCTCCAATTTAAAGATGG - Intergenic
1139247598 16:65461493-65461515 TATGATCTCCACTTTACAGGTGG + Intergenic
1142345484 16:89551222-89551244 CTGGGGCTCCACTGTAAAGACGG - Intronic
1144324180 17:14161825-14161847 TAGGGTCTCCAGCTTGCAGATGG + Intronic
1145193084 17:20864686-20864708 TACAGTCCCCACTGTAAAGATGG + Exonic
1145262097 17:21360647-21360669 TAGAGTCTCCATTTCACAGATGG - Intergenic
1145298934 17:21616407-21616429 TACAGTCCCCACTGTAAAGATGG - Intergenic
1145403497 17:22566684-22566706 TACAGTCCCCACTGTAAAGATGG + Intergenic
1145723422 17:27093154-27093176 TACAGTCCCCACTGTAAAGATGG - Intergenic
1148464251 17:47855582-47855604 TCAGGTCTCCACTCTAAAGTGGG - Intronic
1149086553 17:52724378-52724400 TAGGGTCTCCAGCTTGTAGAAGG + Intergenic
1150298861 17:64031558-64031580 TAGGGTCTCCATTAGTAAGAGGG + Intergenic
1152437465 17:80285223-80285245 TGCTGTCTCCACTTTAAAGATGG + Intronic
1153743834 18:8157069-8157091 CAGGGTCTCCACTTTCACCACGG - Intronic
1157812627 18:50708600-50708622 TAGGGTCTCCACCAGGAAGACGG + Intronic
1158620197 18:59026364-59026386 TATGATCCCCATTTTAAAGAAGG + Intergenic
1159804513 18:72939988-72940010 TACGGTCTCCAATGTACAGATGG + Intergenic
1160833534 19:1114039-1114061 TATGGTGCCCACTTTACAGATGG - Intronic
1163338538 19:16689232-16689254 AAGGGTCTCCACTATACAGATGG - Exonic
1202673155 1_KI270710v1_random:13505-13527 TAGGGGCTCCACTCTCAAGATGG + Intergenic
925791433 2:7491865-7491887 TAGGATTTCCACTTTAGAGGAGG + Intergenic
926044402 2:9699068-9699090 CAGTGTCCCCATTTTAAAGAGGG + Intergenic
926526594 2:13989460-13989482 TAGGGACTTCATATTAAAGATGG + Intergenic
929868970 2:45741877-45741899 CAGGGTCTCTCCTTTAAAGAGGG + Intronic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
930862749 2:56092007-56092029 TATGGTCTCCACTTTGCAGATGG - Intergenic
931812867 2:65872005-65872027 TAGGGTCTCCACTTACAACATGG - Intergenic
932943776 2:76202950-76202972 CAGGGTCTCCAGCTTAGAGATGG - Intergenic
933870522 2:86561285-86561307 TATTGTCTCCACTTTACAGGTGG - Intronic
936646023 2:114374120-114374142 TAGGGTCTCCAGCTTGCAGATGG - Intergenic
940478716 2:154200564-154200586 CCTGGTCTCCACTTTCAAGATGG + Intronic
941138966 2:161753542-161753564 TATCGTCTCCACTTTACAAATGG - Intronic
942855120 2:180536248-180536270 TGGGGTCTGCGCTTTAAAGTTGG - Intergenic
943857074 2:192809516-192809538 TAGGGAATCCACTTTCAAAATGG + Intergenic
943904138 2:193476090-193476112 TAGGGTCACCACTCCAGAGAGGG + Intergenic
944185806 2:196947197-196947219 TAGGATCTCCAGTTTAATGTTGG - Intergenic
946652148 2:221904635-221904657 AAGAGTCTCCACATTAATGAAGG + Intergenic
946930616 2:224666787-224666809 CTGGGTCTCCAATTTACAGATGG - Intergenic
947481429 2:230503936-230503958 TAGGATCTCAACTTTCAAGCTGG - Intronic
947820340 2:233064574-233064596 TATTATCTCCACTTTACAGATGG + Intronic
948512784 2:238481740-238481762 TATTGTCCCCACTTTACAGATGG + Intergenic
1169649275 20:7848936-7848958 AAGGGTTTCCAGTTCAAAGAGGG + Intergenic
1170884604 20:20329306-20329328 TTCTGTCTCCACTTTAAAAAAGG + Intronic
1171561595 20:26131838-26131860 TACAGTCCCCACTGTAAAGATGG + Intergenic
1172009931 20:31840906-31840928 TAGGGTCCACATTTTACAGATGG + Intergenic
1173156485 20:40616668-40616690 GAGCGTCTCCACTTTTACGATGG + Intergenic
1173161591 20:40656784-40656806 TGGGGAATCCACTTTCAAGATGG - Intergenic
1173747546 20:45449408-45449430 TATGGTCCCCAGTTTACAGAGGG + Intergenic
1173862841 20:46295526-46295548 TATCATCTCCACTTTACAGATGG + Intronic
1173912655 20:46681757-46681779 TAGAGTCCCCACCTTCAAGAAGG - Intronic
1174275841 20:49403532-49403554 TAGTATCTCCATTTTACAGATGG + Intronic
1174522222 20:51140670-51140692 TATTATCTCCATTTTAAAGATGG + Intergenic
1174633505 20:51978850-51978872 AAAGCTCTCCACTGTAAAGAGGG - Intergenic
1176634507 21:9177927-9177949 TAGGGGCTCTACTCTCAAGATGG + Intergenic
1176638810 21:9276866-9276888 TAGGGGCTCCACTCTCTAGATGG - Intergenic
1177251767 21:18600910-18600932 TTTGGTCTCCATTTTAAAGATGG + Intergenic
1180372114 22:12049710-12049732 TAGGGGCTCCACTCTCTAGATGG - Intergenic
1180422853 22:12884372-12884394 TAGGGGCTCCACTCTCTAGATGG - Intergenic
1180720036 22:17901249-17901271 TAGGGATTCCTCTTTAAAAAAGG + Intronic
1182767847 22:32771563-32771585 TATTATCTCCATTTTAAAGAAGG - Intronic
1185275815 22:49949862-49949884 ACGGGTCTCCACTATACAGAAGG + Intergenic
949351145 3:3126354-3126376 TAAGTTCTCCACGTTACAGATGG + Intronic
952492409 3:33885166-33885188 TATGGTCCCTACTCTAAAGATGG - Intergenic
953490845 3:43348930-43348952 TAGGGTTTCCACATCACAGAAGG - Exonic
954190255 3:48954643-48954665 TAGGGTTTGCTCTTTAAACAGGG + Intronic
954465759 3:50653859-50653881 TAAGATCTCCATTTTACAGATGG + Intergenic
956040268 3:65138110-65138132 TATTGTGTCCACTTTACAGATGG - Intergenic
957085545 3:75673191-75673213 TAGGGCTTCCACTGTAAAGTCGG + Intergenic
957102049 3:75840249-75840271 TAGGGGCTCTACTCTCAAGATGG + Intergenic
957747846 3:84367565-84367587 TAGGGTCTACACTTGAAGAATGG + Intergenic
958564255 3:95787431-95787453 TACCGTCTCCACTTGGAAGAAGG - Intergenic
959946046 3:112126279-112126301 TAGGTTCTCCTCTTTAAGGAAGG + Intronic
960071708 3:113438456-113438478 TAGGTGCTGCATTTTAAAGATGG - Intronic
960394588 3:117120664-117120686 TAGAATCTCCACTTTGCAGATGG + Intronic
961426866 3:126855335-126855357 TAGCATCTCCATTTTACAGATGG - Intronic
961774604 3:129275360-129275382 TAAGGACTCCACTGTAAATATGG + Intronic
962379151 3:134883190-134883212 TTGGCACTCCACTTTGAAGAAGG + Intronic
963045773 3:141101549-141101571 TATTGTCTCCATTTTACAGATGG - Intronic
963254251 3:143129302-143129324 TATGGTCCCCATTTTACAGAAGG + Intergenic
966412402 3:179657107-179657129 TACTGTCTCCATTTTACAGATGG - Intronic
967370117 3:188734886-188734908 GAGTGTCTCCAATTTCAAGAAGG - Intronic
1202748085 3_GL000221v1_random:128153-128175 TAGGGGCTCCACTCTCTAGATGG + Intergenic
969350922 4:6597400-6597422 TAGAGGCCCCACTTTACAGAGGG + Intronic
970167627 4:13256467-13256489 TAATATCTCCATTTTAAAGATGG + Intergenic
971160451 4:24128267-24128289 TAATGTCTCCATTTTAAAGAAGG - Intergenic
975293424 4:72704464-72704486 TAGGGTGTCCTCTTAAAAAAAGG - Intergenic
975742078 4:77439120-77439142 CAGGGTCTCCACCTTGCAGATGG + Intergenic
977173153 4:93787502-93787524 AAGGATCTCAACTTTAAACAGGG - Intergenic
978979556 4:114926000-114926022 TAGTGTCTCAACTTGAATGATGG + Intronic
979302045 4:119097648-119097670 TAGTGTCTTTACTTTATAGAGGG + Intergenic
981340355 4:143615382-143615404 TAGCTGCTGCACTTTAAAGAGGG - Intronic
981904830 4:149910492-149910514 TAGAATCACAACTTTAAAGAAGG + Intergenic
983084657 4:163428091-163428113 TAGGGTGTCCTATTTAGAGAGGG + Intergenic
1202753697 4_GL000008v2_random:35278-35300 TAGGGGCTCCACTCTCTAGATGG - Intergenic
986977348 5:13409725-13409747 CAGTGGCTCCACTTTTAAGACGG - Intergenic
989173864 5:38501013-38501035 TAGAGGATCCACTTTCAAGATGG - Intronic
993026789 5:82656251-82656273 CATGGTTTCCACTTTCAAGATGG - Intergenic
994509385 5:100684473-100684495 TAGTGGGTCCACTTTCAAGATGG + Intergenic
997175042 5:131766639-131766661 TCGGGTCTCCACCTTGCAGATGG - Intronic
997768754 5:136532352-136532374 CAGGGTCTCCAGCTTATAGATGG + Intergenic
998394571 5:141810403-141810425 TATTGTCTCCATTTTATAGATGG + Intergenic
998542385 5:142994820-142994842 TATGCTCTCCATTTTATAGATGG + Intronic
999172114 5:149604255-149604277 TAGGGTTTCCAGTTAAAATATGG + Intronic
1001109845 5:168886547-168886569 TAGTGTCTCCCCTTTCACGAGGG + Intronic
1004687636 6:17962537-17962559 GAGAGGCTCCACTTGAAAGAGGG + Intronic
1006231628 6:32592914-32592936 CATGGTCTCCACTTCCAAGATGG + Intergenic
1007887065 6:45241670-45241692 TAGGGTCTCCACGATCAAGCTGG + Intronic
1009266305 6:61559497-61559519 TCTGGTCTTCATTTTAAAGAAGG + Intergenic
1009639943 6:66321592-66321614 TAGTGTCTCCATTGTAATGAAGG - Intergenic
1009883654 6:69600072-69600094 TTGGGTATCCATTTTAAGGATGG - Intergenic
1010662955 6:78592630-78592652 CTGGGTCTCCAGTTTGAAGATGG - Intergenic
1012846468 6:104395671-104395693 CTGGGTCTCCAGTTTACAGACGG + Intergenic
1013093116 6:106919348-106919370 CAGTGTCTCCATTTTACAGAGGG + Intergenic
1014767145 6:125419967-125419989 TATAGACTCCATTTTAAAGAAGG - Intergenic
1015280891 6:131433081-131433103 CAGGGTGTCCATTCTAAAGATGG - Intergenic
1017473626 6:154765752-154765774 TAAGTTCTCAACTTTAAAGAAGG - Intronic
1017899980 6:158711452-158711474 CAGGGTCTCCAGTTTGCAGATGG - Intronic
1018103371 6:160461071-160461093 TAGGTTCTCTACTTTGAAAATGG - Intergenic
1019478944 7:1257211-1257233 CAGCCTCTCCACTTTACAGAAGG - Intergenic
1019821050 7:3243013-3243035 TATGATCTTCATTTTAAAGAAGG - Intergenic
1021481066 7:21117633-21117655 TAAATTCTCCACTTAAAAGACGG - Intergenic
1024406639 7:48989822-48989844 CAGGTTCTCCAGATTAAAGATGG - Intergenic
1025276228 7:57583541-57583563 TACAGTCCCCACTGTAAAGATGG - Intergenic
1027498699 7:78921437-78921459 CAGAGTCTGCACTTTAAATACGG + Intronic
1030265290 7:107614837-107614859 TAGGGTCTCTATTTTTGAGACGG - Intronic
1034982768 7:155489390-155489412 AAGCGTCTCCACTTGTAAGAAGG - Intronic
1037165422 8:15822333-15822355 TAGAGTTTGCACTTTACAGATGG + Intergenic
1039188321 8:34942618-34942640 TACTGTCTCCACGTTATAGAGGG - Intergenic
1041348652 8:56927300-56927322 AAGATTCTGCACTTTAAAGATGG + Intergenic
1042492510 8:69416226-69416248 CAGGGTCTCCAGCTTACAGATGG - Intergenic
1043187189 8:77168343-77168365 TAGGATTTCCTCTTTAAGGAAGG + Intergenic
1043811729 8:84750790-84750812 TAGGGTCCCCACTAGCAAGAAGG + Intronic
1044195296 8:89369264-89369286 TAGGGTCTCTGCCTTACAGATGG - Intergenic
1045010914 8:97957697-97957719 TAGGGTCTCATCATTAAAGGGGG + Intronic
1047019809 8:120762965-120762987 TACTATCTCCATTTTAAAGATGG + Intronic
1049041732 8:140117183-140117205 TATTATCTCCACTTTACAGATGG - Intronic
1049052174 8:140207172-140207194 GATGGTCTCCATTTCAAAGATGG + Intronic
1049777204 8:144412251-144412273 CAGGGTCTCCATATCAAAGAGGG + Intronic
1051562166 9:18454099-18454121 TAGGGTCTCCAGCTTAGAGATGG - Intergenic
1051832306 9:21293402-21293424 CAGGGTCTCCAGCTTACAGATGG + Intergenic
1053109466 9:35445140-35445162 GAGTGTCTCCAATTTAGAGATGG - Intergenic
1055744414 9:79427074-79427096 CAGCGGCTCCACTTTCAAGATGG + Intergenic
1056869180 9:90261023-90261045 TAGCTTCTCCACTTTGAAGCTGG - Intergenic
1056964180 9:91152334-91152356 TTGGGTCTCCAGTTTGCAGATGG - Intergenic
1059367211 9:113795553-113795575 TATGATCTCCATTTTAAAGTAGG - Intergenic
1059567184 9:115394596-115394618 TAGCGTCTCTACTTTATAGATGG + Intronic
1059656493 9:116362399-116362421 TAGTGTCTCCATTTTACATATGG - Intronic
1059693563 9:116709350-116709372 GAGTTTCTCCACTTTATAGATGG + Intronic
1059735021 9:117092067-117092089 TAGTGACTGCATTTTAAAGATGG + Intronic
1060234102 9:121850293-121850315 TAGGGTCTCCACTTTAAAGATGG - Intronic
1061915968 9:133754314-133754336 TGGGGTCCCGGCTTTAAAGAGGG + Intergenic
1203716724 Un_KI270742v1:158236-158258 TAGGGGCTCCACTCTCTAGATGG + Intergenic
1203534486 Un_KI270743v1:20001-20023 TAGGGGCTCCACTCTCTAGATGG - Intergenic
1203650955 Un_KI270751v1:121814-121836 TAGGGGCTCCACTCTCAAGATGG + Intergenic
1188494867 X:30773054-30773076 TATTGTCTCCTCTTTACAGATGG + Intergenic
1189764058 X:44351234-44351256 TAGTTTCTGCATTTTAAAGATGG + Intergenic
1189944937 X:46168451-46168473 TAGGGGCTCCACTTCCAAGATGG + Intergenic
1192607629 X:72535787-72535809 TAGAGTATTCACTTTATAGAAGG - Intronic
1194716759 X:97295554-97295576 TATGGTCTCCATTTTACAGTTGG + Intronic
1197654391 X:129100685-129100707 GAGGGTCTCCAGTTTAATAAAGG + Intergenic
1197827894 X:130610259-130610281 TCTGGTCTCCACTTCCAAGATGG - Intergenic
1198812914 X:140553927-140553949 CAGGGTCTCCACTCTAAGAAGGG + Intergenic
1198847613 X:140929504-140929526 TAAGATCACCACTTTAAGGATGG - Intergenic
1201170919 Y:11263180-11263202 TAGGGGCTCCACTCTCAAGATGG + Intergenic
1201337751 Y:12898414-12898436 TAGGGTCTCCACTCCTGAGAGGG + Intergenic
1202627660 Y:56876820-56876842 TAGGGCATCCAATTTCAAGACGG - Intergenic