ID: 1060235123

View in Genome Browser
Species Human (GRCh38)
Location 9:121857296-121857318
Sequence TAAGTGATACAGAGGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 186}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060235123_1060235129 -3 Left 1060235123 9:121857296-121857318 CCCTGCCCCCTCTGTATCACTTA 0: 1
1: 0
2: 0
3: 18
4: 186
Right 1060235129 9:121857316-121857338 TTAAGTGAACAAGCACTGCTTGG No data
1060235123_1060235139 29 Left 1060235123 9:121857296-121857318 CCCTGCCCCCTCTGTATCACTTA 0: 1
1: 0
2: 0
3: 18
4: 186
Right 1060235139 9:121857348-121857370 GGATGGGGGGAGAGCACCCTGGG No data
1060235123_1060235131 12 Left 1060235123 9:121857296-121857318 CCCTGCCCCCTCTGTATCACTTA 0: 1
1: 0
2: 0
3: 18
4: 186
Right 1060235131 9:121857331-121857353 CTGCTTGGTGTAGCCCTGGATGG No data
1060235123_1060235132 13 Left 1060235123 9:121857296-121857318 CCCTGCCCCCTCTGTATCACTTA 0: 1
1: 0
2: 0
3: 18
4: 186
Right 1060235132 9:121857332-121857354 TGCTTGGTGTAGCCCTGGATGGG No data
1060235123_1060235135 16 Left 1060235123 9:121857296-121857318 CCCTGCCCCCTCTGTATCACTTA 0: 1
1: 0
2: 0
3: 18
4: 186
Right 1060235135 9:121857335-121857357 TTGGTGTAGCCCTGGATGGGGGG No data
1060235123_1060235138 28 Left 1060235123 9:121857296-121857318 CCCTGCCCCCTCTGTATCACTTA 0: 1
1: 0
2: 0
3: 18
4: 186
Right 1060235138 9:121857347-121857369 TGGATGGGGGGAGAGCACCCTGG No data
1060235123_1060235133 14 Left 1060235123 9:121857296-121857318 CCCTGCCCCCTCTGTATCACTTA 0: 1
1: 0
2: 0
3: 18
4: 186
Right 1060235133 9:121857333-121857355 GCTTGGTGTAGCCCTGGATGGGG No data
1060235123_1060235130 8 Left 1060235123 9:121857296-121857318 CCCTGCCCCCTCTGTATCACTTA 0: 1
1: 0
2: 0
3: 18
4: 186
Right 1060235130 9:121857327-121857349 AGCACTGCTTGGTGTAGCCCTGG No data
1060235123_1060235134 15 Left 1060235123 9:121857296-121857318 CCCTGCCCCCTCTGTATCACTTA 0: 1
1: 0
2: 0
3: 18
4: 186
Right 1060235134 9:121857334-121857356 CTTGGTGTAGCCCTGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060235123 Original CRISPR TAAGTGATACAGAGGGGGCA GGG (reversed) Intronic
901870674 1:12137413-12137435 TGAGTAATTCAGAGGAGGCAGGG - Intronic
902384981 1:16071467-16071489 TCAGTGATAAGGAGAGGGCAGGG + Intronic
905222254 1:36456232-36456254 TCGGTAATACAGAGGGGGGAAGG + Exonic
907769251 1:57443587-57443609 TAAGTGATACAGATGAGAGAGGG - Intronic
908336202 1:63126412-63126434 GAAATAATACAGAGAGGGCAGGG + Intergenic
910050866 1:82973058-82973080 TAAATGATATGGAGGGGGGAAGG + Intergenic
910463823 1:87475328-87475350 TAAGTGAGACAGAAGGGACAGGG - Intergenic
910958820 1:92738840-92738862 AAAGAGATTCAGAGGTGGCAGGG - Intronic
912303567 1:108541710-108541732 TATGTGGAATAGAGGGGGCAAGG - Intergenic
913070092 1:115290685-115290707 TAAGAGATAGAGAAGGGGCAGGG - Intronic
914868884 1:151457586-151457608 AAAGGGAAACGGAGGGGGCAGGG - Intronic
914947101 1:152077569-152077591 AATGTGATAGAGAGGAGGCAGGG - Intergenic
916017996 1:160767265-160767287 GAAGAGATACAGAGAGGGGAGGG + Intergenic
917783756 1:178429342-178429364 TAAAAGATACATAGAGGGCAGGG - Intronic
917908365 1:179612978-179613000 TCTGTAAGACAGAGGGGGCAGGG - Intronic
918677993 1:187313933-187313955 GAACTGATACTGAGGGAGCAAGG - Intergenic
920690051 1:208139365-208139387 TGTGTGATGAAGAGGGGGCAGGG - Intronic
920880189 1:209872589-209872611 GATGTGATTCAGAGGGGGCTAGG - Intergenic
921073836 1:211684155-211684177 TCAGTGATACAGGGCAGGCAAGG + Intergenic
921598143 1:217077317-217077339 AAATTGATAGAAAGGGGGCATGG + Intronic
922034645 1:221836290-221836312 TAAATGAGACAGAGGGTGAAGGG + Intergenic
922872541 1:228915053-228915075 AAAGTGGTATAGAGGGGGCTGGG - Intergenic
923763292 1:236867986-236868008 TAGGTGATAAAGCAGGGGCAAGG + Intronic
1064445446 10:15388795-15388817 AAAGTCATACAAAGGAGGCAGGG - Intergenic
1066212271 10:33251881-33251903 TAAATGGTACAGAAGGGGGAAGG + Intronic
1071944995 10:90634417-90634439 TAAATGATACCAAGGGGGCATGG - Intergenic
1074732795 10:116395550-116395572 TAAATGATACGGAAGGGGGAAGG - Intergenic
1075521098 10:123143945-123143967 TAAGTGAAACATAGGTTGCAGGG + Intergenic
1075621204 10:123929556-123929578 GAAGTGAAACAGCGAGGGCAGGG - Intronic
1077290862 11:1791646-1791668 TAAATGAAACAGACTGGGCATGG - Intergenic
1078838775 11:15057890-15057912 AAAGTGAGACAGAGGAGGAAAGG - Intronic
1081589699 11:44412906-44412928 GAAGAGAGACAGATGGGGCAGGG + Intergenic
1083655528 11:64227373-64227395 AAGGAGATACACAGGGGGCAGGG - Intronic
1085365529 11:75939268-75939290 AAAATGATACAGAGGTAGCAAGG - Intronic
1085929433 11:81063586-81063608 TAAGTGAAAGAGAAGAGGCAAGG - Intergenic
1086288679 11:85279333-85279355 TAAGTGATAAGGAGAGGGGAGGG + Intronic
1086415501 11:86585451-86585473 TGAGTGAGAGAGAGGGGTCAAGG + Intronic
1086542741 11:87932118-87932140 TAAGAGATTCAAGGGGGGCAAGG + Intergenic
1089198508 11:116709531-116709553 TAAATGCTACAGTGGGGGCCAGG - Intergenic
1089315386 11:117587774-117587796 TAAGGGACAAAGAGGAGGCATGG - Intronic
1089361175 11:117887695-117887717 AAAGAGAGACAGAGAGGGCAGGG - Intergenic
1093290252 12:17310947-17310969 TTACTAATACAGAGGGGACAAGG + Intergenic
1093459878 12:19398332-19398354 TAAGTGAGACACATGGTGCAGGG - Intergenic
1094006510 12:25758213-25758235 TATGTGATGCAGAGTGGGGAAGG + Intergenic
1094500468 12:31016586-31016608 TAAGTGTTATAAAGGGAGCATGG + Intergenic
1094842125 12:34346551-34346573 TATGCGCTACAGAGGGGGCGTGG + Intergenic
1095556519 12:43512710-43512732 TAAGTGATTCAGGGGATGCAAGG - Intronic
1096632476 12:52937390-52937412 AGAGAGATACAGATGGGGCAGGG + Intronic
1096743664 12:53712123-53712145 TAAGAGAGACAGAGGGGAAAGGG + Intronic
1096910990 12:54983727-54983749 TTAGTGGCACAGAAGGGGCATGG + Intronic
1097147299 12:56950672-56950694 TAAGGGACACAGAGAGGGCACGG + Intergenic
1097700575 12:62816154-62816176 TAATGGATACAGAGGCAGCATGG + Intronic
1100629276 12:96371112-96371134 TGAGTGATGCAGTGGGGGCAGGG - Intronic
1102474323 12:113179037-113179059 AAAGTGATTGAGAGAGGGCAGGG + Intronic
1103205387 12:119125058-119125080 TGAGTGATGCAGAGGAGACATGG + Intronic
1103836736 12:123827511-123827533 TGGGTGGGACAGAGGGGGCATGG + Intronic
1104704134 12:130930441-130930463 TAAGTGCCACAGAGGAAGCATGG - Intergenic
1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG + Intergenic
1106131454 13:26943078-26943100 GAAGTGTTTCAAAGGGGGCAAGG - Intergenic
1106622639 13:31385737-31385759 TAAATGATACAGAAGGGGGCGGG - Intergenic
1108363752 13:49690881-49690903 TAAATGCCCCAGAGGGGGCAAGG - Intronic
1108836198 13:54552681-54552703 GAAGTGAGAGAGAGGGGGGAGGG - Intergenic
1109711456 13:66165519-66165541 TAAATGATACGGAAGGGGGAAGG - Intergenic
1110273193 13:73614279-73614301 GAAGTGATGCAGAGTGGCCAGGG + Intergenic
1110619079 13:77575080-77575102 TAAGGGCTACAGAGAGGTCAAGG - Intronic
1110735972 13:78937001-78937023 TAAGAGATAAATAAGGGGCAAGG - Intergenic
1112686342 13:101832251-101832273 TAAGTGCTCCAGAGAGAGCACGG + Intronic
1113618552 13:111697660-111697682 TAAGAGAAACAGAGATGGCATGG + Intergenic
1113624081 13:111782921-111782943 TAAGAGAAACAGAGATGGCATGG + Intergenic
1114246737 14:20921302-20921324 TAAGAGATATAGAGGCTGCAGGG + Intergenic
1114790956 14:25657809-25657831 TAAGTGATTCAGAGGAAACAAGG - Intergenic
1114991297 14:28293448-28293470 TAAAAGATACAGAAGGGGCCAGG - Intergenic
1115214459 14:31001027-31001049 TGAGTGAGGCAGAGGGGGTAGGG + Intronic
1119352053 14:73974013-73974035 TAAGTGAGAGAGAGGGAGGAAGG + Intronic
1123991349 15:25685884-25685906 CAAGTGATAGAAAGGGGGCTTGG + Intronic
1127054804 15:55120722-55120744 CAAATGAAACAGAGGGAGCAAGG - Intergenic
1127411888 15:58717099-58717121 TAAGTGATAAAGGGGAGTCAAGG - Intronic
1128150725 15:65362099-65362121 GAAGTGGTACAGAGGGAGCTGGG + Intronic
1129351734 15:74959298-74959320 TAAGTGCTGCAGAGGGAGCGCGG - Intronic
1129779194 15:78258865-78258887 ACAGTGATGGAGAGGGGGCATGG - Intergenic
1130602569 15:85286608-85286630 TCAGTGATACAGATGGGGCTGGG + Intergenic
1131551833 15:93364014-93364036 TAAGTAATACAGACCGGGCACGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132941670 16:2511586-2511608 TGAGTAATACAGAGTGGGGAGGG + Intronic
1135754362 16:25083999-25084021 AAAGTGAGACAGAGGGTGTAGGG + Intergenic
1136355337 16:29741578-29741600 TGAGTGATAGAGATGGGACAGGG + Intergenic
1136573585 16:31110536-31110558 TAAGTGAGACAGAGGAGACTGGG + Intronic
1136640820 16:31563748-31563770 TTAGGGAGACAGAGGGGGCAGGG - Intergenic
1136664145 16:31793566-31793588 TTAGGGAGACAGAGGGGGCAGGG + Intronic
1137464734 16:48697828-48697850 TGAGTAATACTGAAGGGGCAGGG + Intergenic
1139779092 16:69335977-69335999 TAAGGGATACAGAGGCAGCCAGG - Intronic
1140045489 16:71437869-71437891 TAAGTGAGGCAGAGGGGAGAAGG - Intergenic
1140404388 16:74698795-74698817 TAAATTATACAGTGGTGGCATGG + Intronic
1142653667 17:1374841-1374863 TAAGGGATGCAGAGGGGGTTGGG - Intronic
1143131659 17:4682200-4682222 TAAGAGATACAGAAAAGGCAAGG + Intronic
1147338719 17:39741453-39741475 TGAGTGATGCAGAGGGGAGAAGG - Intronic
1148149536 17:45388482-45388504 TAACAGATACAGATCGGGCATGG + Intergenic
1156979825 18:43272713-43272735 TAAGTGATACAGTGGGAATAAGG - Intronic
1157092703 18:44654786-44654808 TATGTGATGCAGACGGTGCATGG + Intergenic
1157136881 18:45064575-45064597 TAAGTGATGCAGAGCAGCCAAGG + Exonic
1158132589 18:54169404-54169426 TCAGTGCTTCAGAGGGAGCAGGG + Intronic
1160593568 18:79958944-79958966 TAAGTAAAACAGAGCGGGCCAGG + Intergenic
1161785130 19:6319814-6319836 TAAATAATACAGAAGGGGCCAGG + Intronic
1162465236 19:10835782-10835804 TAAGAGATCCAGAGGGGGCGGGG - Intronic
1163267642 19:16230991-16231013 TAAGAAATACAGAGAGGGCCAGG + Intronic
1165025364 19:32957097-32957119 TGAGTGATACAGAGGTGCCCAGG - Intronic
925382064 2:3435324-3435346 TAACTGTTACTGGGGGGGCAGGG + Intronic
925424680 2:3739255-3739277 TAAATGATACAGAAGGGGGAAGG + Intronic
928515366 2:32039699-32039721 TAAGTGAGAAAGTGGGGGAAAGG + Intronic
931163015 2:59715152-59715174 TAAGAGAAAGAGAGGGGTCACGG - Intergenic
932224756 2:70030749-70030771 TATAAGATACAGAGGGGACAGGG + Intergenic
934040213 2:88122137-88122159 TAACTCCTCCAGAGGGGGCATGG - Intergenic
937291424 2:120784488-120784510 CAAGTGAGGCTGAGGGGGCAGGG + Intronic
937885158 2:126894597-126894619 TAACTGAGACAGTGGGGACAAGG - Intergenic
945003660 2:205378391-205378413 TAAGGGAAACAGAGGTGGAAGGG + Intronic
946842525 2:223832685-223832707 AAATTGATACAGAAGGGGAAGGG + Intronic
947047358 2:226003154-226003176 AAAGGTATCCAGAGGGGGCATGG + Intergenic
1168981296 20:2006185-2006207 AAACTGATACAGCTGGGGCAAGG + Intergenic
1170200756 20:13741170-13741192 TTAGTGATAGAGAGTTGGCAGGG - Intronic
1170264574 20:14451113-14451135 GAAGTGAGACAGAGGAGGAAGGG + Intronic
1170591769 20:17776885-17776907 TGAGAGAGACAGTGGGGGCAGGG + Intergenic
1179246477 21:39638107-39638129 TAAATGATACTGAAGGGGGAAGG + Intronic
1180618454 22:17144206-17144228 TAAGCAATACAGAGAGGACAGGG + Intronic
1181044056 22:20206347-20206369 TAAATGATACAGAGGAGGGACGG - Intergenic
1182658481 22:31908235-31908257 TTAGTGAGACAGAGCGGGCATGG - Intergenic
950014244 3:9744714-9744736 AAAGTGATACAATGGAGGCAGGG - Intronic
950575246 3:13828313-13828335 TGAGAAATAGAGAGGGGGCAAGG + Intronic
950854771 3:16094870-16094892 TCAGTGATGCAGTGTGGGCAGGG + Intergenic
952459681 3:33511483-33511505 AATGTGATACAGAGGGCTCAAGG - Intronic
953022850 3:39126975-39126997 GAAGTGATGCAGGGGTGGCAGGG + Intronic
954574052 3:51665158-51665180 TGGGGGATACAGAGGGGGCGGGG - Exonic
958126505 3:89363196-89363218 AGAGAGATAGAGAGGGGGCAGGG + Intronic
959369470 3:105504876-105504898 TAAATGATACAGAAGGGGGAAGG - Intronic
960157888 3:114316626-114316648 TAAAATATACAGAGGGAGCAGGG - Intergenic
962202879 3:133415102-133415124 TAAGTAGAACAGAGGAGGCAGGG - Intronic
963751132 3:149181076-149181098 TAAGTGACCCTAAGGGGGCAAGG - Intronic
963834824 3:150047861-150047883 TAAGTGATAGAGTGGGGCAAAGG - Intronic
966817132 3:183898511-183898533 TAAGTTAAAAAGAGGGGGCCAGG - Intergenic
969229198 4:5817921-5817943 AAAGTGAGACAGAATGGGCAAGG - Intronic
969554110 4:7894590-7894612 TCAGGGAGACAGAGGGGGCCTGG + Intronic
970888815 4:21018644-21018666 TAAGTGAAGGAGAGGGGGAAGGG - Intronic
974163387 4:58169113-58169135 CAAGTGTTACAGAGGGGAAAAGG - Intergenic
975183943 4:71379381-71379403 TAAGTGATAGAGAGATTGCAAGG - Intronic
975377946 4:73667197-73667219 TAAGTGCTAGGGAGGGGGTATGG - Intergenic
978157504 4:105506498-105506520 TATGTGAAACAGTGGGGACATGG - Intergenic
979587029 4:122432587-122432609 AAAGTGCTGCAGAGGGGTCAAGG + Intergenic
982808346 4:159794398-159794420 AAGGTGATACAGATGTGGCATGG + Intergenic
983059665 4:163143560-163143582 TAAGTTATCTAGAGGGGGCTAGG + Intronic
983071673 4:163275238-163275260 TTAGTGGGACAGAGTGGGCAAGG - Intergenic
985369616 4:189271806-189271828 TGAGTGATACTGAAGGGTCAAGG + Intergenic
985519953 5:369533-369555 CAAGTGACACAGAGGGAGCCCGG - Intronic
987322516 5:16783907-16783929 TGAGTAATACTGAGGGGACAAGG + Intronic
989814901 5:45724133-45724155 TAAGAGAAAGAGAGGAGGCAAGG + Intergenic
990963473 5:61419115-61419137 TAAGTTATAAAGAGGAGGCCGGG - Intronic
991994157 5:72370755-72370777 TAAGGGATAGAGAGGAGGAAAGG - Intergenic
992451430 5:76879731-76879753 TAAGTGATACAAAAGAGGCATGG + Intronic
993784796 5:92116690-92116712 GAAGTGAGACAGAGGGAGCGAGG + Intergenic
994321427 5:98399364-98399386 TAAGTGATACTGTGAGGGAAAGG - Intergenic
994469809 5:100188693-100188715 TAAATGATAGAGATGGAGCAGGG + Intergenic
997509635 5:134445044-134445066 CGAGTGATACAGTGAGGGCAAGG + Intergenic
1001280046 5:170380304-170380326 TCAGTGATGCAGAGTGGGTAGGG - Intronic
1002687852 5:181028313-181028335 TAAATGATACGGAAGGGGGAAGG - Intergenic
1003519078 6:6842198-6842220 TAAGTGAAAGAGAGTGAGCAAGG - Intergenic
1003783005 6:9450496-9450518 TAAGTGATAGAGATAGGGTACGG - Intergenic
1004506052 6:16247663-16247685 TAAGAGATACAGGCCGGGCATGG - Intronic
1005153841 6:22781175-22781197 GAAGTGACACAGAGGGGCCCAGG + Intergenic
1007192762 6:40033546-40033568 GAAGTGATACAGAGAAGGGAAGG + Intergenic
1007608806 6:43135498-43135520 CAAGTGATAGAGAAAGGGCAGGG + Intronic
1008469324 6:51865597-51865619 TAAGAGGTCCAGAGAGGGCAGGG - Intronic
1009543696 6:64999446-64999468 TAAATGATACAGAAGGGGGAAGG + Intronic
1010497587 6:76554146-76554168 TAATTGTAACAGAGGTGGCAGGG - Intergenic
1011912376 6:92457099-92457121 TAAGTGGTTGAGAGTGGGCAGGG + Intergenic
1016369468 6:143357209-143357231 TAAAGGACACAGAGAGGGCAAGG - Intergenic
1019505632 7:1389083-1389105 GAAGGGACACAGAGGGGCCATGG + Intergenic
1021924838 7:25524238-25524260 TAAGTGAAAAAGAGTGGGTATGG + Intergenic
1023677012 7:42641410-42641432 CAAGTGATCCAGAGGCAGCAGGG - Intergenic
1024268204 7:47622503-47622525 TAAATGATACGGAAGGGGAAAGG - Intergenic
1025614238 7:63104580-63104602 CAAATGAAACAGACGGGGCATGG - Intergenic
1029950044 7:104574305-104574327 TAAGTTCTACGAAGGGGGCAGGG + Intronic
1031880127 7:127188442-127188464 TGAGTGCTCCAGATGGGGCATGG - Intronic
1033666699 7:143447368-143447390 TAAGTGCTTCAGAGGATGCATGG - Intergenic
1034125916 7:148671501-148671523 AAACTGATACAGTGGGGGAAAGG + Intergenic
1036919372 8:12836648-12836670 CTAGTGATACAGAAGGGGGAAGG - Intergenic
1038240409 8:25802950-25802972 TATGTGGTACAGGGAGGGCAAGG - Intergenic
1039008288 8:33065288-33065310 TAAATCATAAAGAGGGGGGAAGG + Intergenic
1039716243 8:40112648-40112670 CAAATGAAAGAGAGGGGGCAAGG + Intergenic
1042027453 8:64439132-64439154 TAAGTGAAAAGGAGGGGGAAAGG + Intergenic
1047640973 8:126821231-126821253 TAAATGATACGGAAGGGGGAAGG - Intergenic
1047661130 8:127038153-127038175 TAAGTGATACAGACTGTGAATGG + Intergenic
1050061559 9:1714891-1714913 TAAGTGATAAAGAGGGAGTCTGG - Intergenic
1058656743 9:107229218-107229240 AAGGGGATACGGAGGGGGCAGGG + Intergenic
1060235123 9:121857296-121857318 TAAGTGATACAGAGGGGGCAGGG - Intronic
1062691189 9:137842529-137842551 TGGATGATACAGAGGGGGGATGG - Intronic
1062691222 9:137842631-137842653 TGGATGATACAGAGGGGGGACGG - Intronic
1186255889 X:7719116-7719138 TAATTGATAAAGAAGTGGCAGGG - Intergenic
1186651860 X:11569690-11569712 TATATGCTACAGAGGGTGCAGGG - Intronic
1188812590 X:34669798-34669820 TATGTTATACAGAGGGAACAAGG + Intergenic
1191836605 X:65470147-65470169 TAAGTCCTTCCGAGGGGGCAAGG + Intronic
1192211821 X:69132702-69132724 TGAGTGAAACAGAAAGGGCAGGG - Intergenic
1195409510 X:104554665-104554687 TAGGTGATACAGAGTGGTCCAGG - Intergenic
1196294868 X:113985984-113986006 TGACTAATACAGAGGGGGTAAGG - Intergenic
1198766353 X:140083266-140083288 TAAGTGATTCAGATGAGGCTAGG - Intergenic
1199202781 X:145112537-145112559 TTACTGATATAGAGGGTGCATGG - Intergenic
1200852275 Y:7896172-7896194 TAGATGATACAGAGGGCCCATGG + Intergenic
1201532496 Y:15007384-15007406 TCAGTGACACAGTGGGGGCAGGG + Intergenic