ID: 1060235773

View in Genome Browser
Species Human (GRCh38)
Location 9:121861707-121861729
Sequence GTTGACATGCTGTCATCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060235773_1060235777 25 Left 1060235773 9:121861707-121861729 CCCAAGGATGACAGCATGTCAAC 0: 1
1: 0
2: 1
3: 15
4: 158
Right 1060235777 9:121861755-121861777 GTCCAGAAGCAATTTCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060235773 Original CRISPR GTTGACATGCTGTCATCCTT GGG (reversed) Intronic
901392857 1:8958509-8958531 GTTAACATGTAGTCATCCTATGG - Intronic
904349678 1:29896924-29896946 GTTGAGACGCTGTCATCCATCGG - Intergenic
904583625 1:31566349-31566371 GTTGCCATGTTGTCCTCCGTGGG - Intergenic
905186349 1:36199764-36199786 GTTGATGTGCTGTCAACCTCAGG - Intergenic
905705917 1:40057688-40057710 TCTGGCATGCTGTCATCTTTGGG + Intronic
907618813 1:55954226-55954248 ATAGTCATTCTGTCATCCTTAGG - Intergenic
910318944 1:85921762-85921784 GCTGAGAAGCTGTGATCCTTTGG - Intronic
910455945 1:87397409-87397431 GTAGACATGCAGCCATCCTGGGG + Intergenic
912058382 1:105633098-105633120 GTTGACATGCTGTCAGCCTGAGG - Intergenic
913836865 1:123348941-123348963 GTGGATATTCTGTCATCTTTTGG + Intergenic
917472632 1:175338757-175338779 GTTGCTATGTTGCCATCCTTGGG - Intronic
917536268 1:175876806-175876828 GGTGACTTGCTGTCACCCTTTGG - Intergenic
918970492 1:191409704-191409726 GATGACATGCTATCATCCATGGG + Intergenic
920064521 1:203257576-203257598 GGTGACAAGCTGTGATCCTTCGG - Intronic
922768596 1:228169537-228169559 GTTGACATGCCATCATCACTTGG + Intronic
1063934832 10:11066638-11066660 GCTGACATAGTATCATCCTTTGG - Intronic
1066398090 10:35046562-35046584 GTTGGTTTGCTGTCATCCTTAGG - Intronic
1068251621 10:54449662-54449684 GTTGTTATGCTGTCTTGCTTAGG - Intronic
1068509138 10:57941642-57941664 GAAGACATGCTTTCATCCTTGGG - Intergenic
1071884621 10:89936579-89936601 GTTGAGAAGCTGTGTTCCTTTGG + Intergenic
1074239100 10:111619321-111619343 GTTGAAATGCTGTCATCTATTGG - Intergenic
1074242612 10:111654275-111654297 GTTGAGATGATGTCAGCCTGAGG + Intergenic
1077793621 11:5467890-5467912 AGTCACATGCTGTCATCATTGGG - Intronic
1078530718 11:12134909-12134931 GGTCACATGCTGTCTTCCTGGGG - Intronic
1080352198 11:31398276-31398298 GTTGACTTTCTCTCATCATTAGG + Intronic
1083157382 11:60832536-60832558 TTTGACATTCTCTCACCCTTGGG + Intergenic
1083325106 11:61869209-61869231 GTTGAGATAATGGCATCCTTGGG - Intergenic
1085362535 11:75903509-75903531 GTTTTCCTGCTGTCATGCTTTGG + Intronic
1085957148 11:81412723-81412745 GCTAACATGCAGTGATCCTTTGG - Intergenic
1086298321 11:85396372-85396394 GTTGAGAAGCTGTGATCCTTTGG - Intronic
1087864428 11:103206652-103206674 TTTGACATGCTATCTTCTTTTGG - Intronic
1089323230 11:117640348-117640370 TGTGACCTGCTTTCATCCTTAGG + Intronic
1089535927 11:119160785-119160807 GCTGCAATGCTGTCATCCCTGGG - Intronic
1093978448 12:25449785-25449807 TTTGACATACTGCCATCATTGGG + Intronic
1094191766 12:27705584-27705606 GCTAACATGCTGCCATCCATCGG - Intergenic
1096030437 12:48409466-48409488 GGTGAGAAGCTGTCATCCTTTGG + Intergenic
1098544075 12:71691816-71691838 CTTGAAATTCTGTCTTCCTTGGG + Intronic
1100525063 12:95411243-95411265 GCTGACATTCTGCCAGCCTTTGG - Intergenic
1102731401 12:115114120-115114142 CTTGACATTCTGTCATCTTCTGG - Intergenic
1103792464 12:123481404-123481426 GCTGCCATGCTGCCATCCTCAGG + Intronic
1103961424 12:124611418-124611440 GTTGGCATGGTGACCTCCTTGGG + Intergenic
1108208115 13:48111785-48111807 GTTGACTTGTTGGCATCCTAAGG + Intergenic
1108920241 13:55664374-55664396 GTTGACATGATGTCAGCCCGAGG + Intergenic
1114906901 14:27139930-27139952 GTTGACAGGCTGTCTGACTTAGG + Intergenic
1115901809 14:38159470-38159492 GATGACATTCAATCATCCTTAGG - Intergenic
1119668298 14:76499890-76499912 CTTGACATTCTTTCATCCTTGGG - Exonic
1120113029 14:80580672-80580694 ATTGATTTGATGTCATCCTTTGG - Intronic
1120161923 14:81155155-81155177 ATTGACATCCTTTCATCCCTTGG + Intergenic
1120634677 14:86936951-86936973 GATAACATGATGTCAGCCTTTGG - Intergenic
1121140108 14:91534125-91534147 GTTCACGTGTTCTCATCCTTTGG + Intergenic
1122010874 14:98745816-98745838 GCTGACATGCTCTTATGCTTGGG + Intergenic
1122318753 14:100840860-100840882 GCAGACATGCGGTCAGCCTTTGG - Intergenic
1124945587 15:34262603-34262625 GTTAACATGCCGCCATCCATGGG + Intronic
1125620241 15:41054340-41054362 GTTAATTTGCTGACATCCTTTGG - Intronic
1125784421 15:42302448-42302470 GTTGAGAAGCTGTGATCGTTTGG - Intronic
1128218273 15:65949520-65949542 ATAGAAATGCTGTCATCCTGGGG + Intronic
1129502208 15:76050380-76050402 GATGAGATGCTGTCATACTGAGG - Intronic
1134166014 16:11930154-11930176 GGTGAGTTGTTGTCATCCTTAGG - Intronic
1134494705 16:14723573-14723595 GGTGAGTTGTTGTCATCCTTAGG + Intronic
1134500088 16:14762693-14762715 GGTGAGTTGTTGTCATCCTTAGG + Intronic
1134526629 16:14949309-14949331 GGTGAGTTGTTGTCATCCTTAGG + Intronic
1134545773 16:15107036-15107058 GGTGAGTTGTTGTCATCCTTAGG - Intronic
1134580492 16:15366357-15366379 GGTGAGTTGTTGTCATCCTTAGG - Intronic
1134714207 16:16347782-16347804 GGTGAGTTGTTGTCATCCTTAGG + Intergenic
1134722081 16:16391146-16391168 GGTGAGTTGTTGTCATCCTTAGG + Intronic
1134945346 16:18320723-18320745 GGTGAGTTGTTGTCATCCTTAGG - Intronic
1134952610 16:18360876-18360898 GGTGAGTTGTTGTCATCCTTAGG - Intergenic
1135311405 16:21407575-21407597 GGTGAGTTGTTGTCATCCTTAGG - Intronic
1135364357 16:21840026-21840048 GGTGAGTTGTTGTCATCCTTAGG - Intronic
1135447486 16:22531322-22531344 GGTGAGTTGTTGTCATCCTTAGG + Intronic
1136150562 16:28345475-28345497 GGTGAGTTGTTGTCATCCTTAGG - Intronic
1136166799 16:28459313-28459335 GGTGAGTTGTTGTCATCCTTAGG - Intronic
1136196176 16:28655719-28655741 GGTGAGTTGTTGTCATCCTTAGG + Intronic
1136212517 16:28769844-28769866 GGTGAGTTGTTGTCATCCTTAGG + Intronic
1136257238 16:29049752-29049774 GGTGAGTTGTTGTCATCCTTAGG + Intronic
1136308110 16:29386571-29386593 GGTGAGTTGTTGTCATCCTTAGG - Intronic
1136321526 16:29488109-29488131 GGTGAGTTGTTGTCATCCTTAGG - Intronic
1136436206 16:30228079-30228101 GGTGAGTTGTTGTCATCCTTAGG - Intronic
1136469787 16:30472548-30472570 CCTGACATGCTGTCAGCTTTTGG + Intergenic
1137805525 16:51301395-51301417 GTTGACTTGCTGTGGACCTTGGG + Intergenic
1139855803 16:69978988-69979010 GGTGAGTTGTTGTCATCCTTAGG - Intergenic
1140366928 16:74389087-74389109 GGTGAGTTGTTGTCATCCTTAGG + Intronic
1142542819 17:674091-674113 CTTGAAATGCTCTCATCCTCCGG - Intronic
1143408149 17:6691655-6691677 GTGGACATTCTCTCCTCCTTTGG - Intronic
1148193167 17:45694204-45694226 GTTGACATGATGCCATCAGTGGG + Intergenic
1148670926 17:49409457-49409479 GTTGACATTCTGTAAATCTTAGG + Exonic
1149418667 17:56487216-56487238 GTTGACACTCTACCATCCTTTGG + Intronic
1151507632 17:74539910-74539932 TGTGACTTGCTGTCATCCTGGGG + Intergenic
1151555766 17:74846000-74846022 GTGGAAATGCTGACAACCTTGGG + Intronic
1152328414 17:79656140-79656162 GTTGAAAAGCTGCCTTCCTTTGG - Intergenic
1154117276 18:11622197-11622219 GGTGAGTTGTTGTCATCCTTAGG - Intergenic
1158858038 18:61563662-61563684 GGTGACATGCTGCGATACTTTGG + Intergenic
1159434206 18:68394962-68394984 GTTAAGATGCTGACATCCTTGGG + Intergenic
1159620011 18:70626447-70626469 TTTGACATGCTGTTTTCCTTTGG + Intergenic
1163799394 19:19355626-19355648 GTTGGAATGCTGCCTTCCTTGGG - Intronic
1164091084 19:21952765-21952787 GGTGAGGAGCTGTCATCCTTTGG - Intronic
1167801227 19:51743643-51743665 GATGACATGATGTGGTCCTTGGG - Intergenic
925429221 2:3776504-3776526 CTTGCAATGCTGTCTTCCTTTGG + Intronic
925717980 2:6802447-6802469 GTTGACATGCTGACAACATATGG - Intergenic
928506278 2:31956521-31956543 TTTTACATGGTGTCATCCTCTGG - Intronic
930652387 2:53975521-53975543 GATAACGTGCTGTTATCCTTTGG - Intronic
931931664 2:67144286-67144308 GTTGAAATGCTATTATCCTTGGG + Intergenic
933779777 2:85793278-85793300 GACAACATGCTTTCATCCTTTGG + Intergenic
935307012 2:101747006-101747028 GTTGGCATCCTGACATCCTGAGG + Intronic
935604629 2:104958655-104958677 GGTGAGAAGCTGTGATCCTTTGG + Intergenic
939495080 2:142918460-142918482 GAGGACCTGATGTCATCCTTGGG + Intronic
943572042 2:189585019-189585041 ATTGACATGCTGTAATAATTGGG - Intergenic
943987355 2:194639870-194639892 GTTGAGGAGCTGTGATCCTTTGG - Intergenic
1170599574 20:17830992-17831014 TTTTACATCCTGTCATCCGTAGG - Intergenic
1170856263 20:20058514-20058536 GGTCACATGCTTTCCTCCTTAGG - Intronic
1173978412 20:47204704-47204726 CTTTCCATGCTGTAATCCTTCGG - Intergenic
1177313345 21:19425250-19425272 GGTGACAAGTTGTGATCCTTTGG - Intergenic
1177835208 21:26179953-26179975 CCTGACATACTGTAATCCTTAGG - Intergenic
1178134641 21:29613807-29613829 GTTGAAATGCTCTCATCATATGG + Intronic
1179124230 21:38577372-38577394 GATGACATGCTGGGAACCTTAGG + Intronic
1185122986 22:48984451-48984473 ATTAAAATGCAGTCATCCTTTGG + Intergenic
951757948 3:26112885-26112907 GCTGACATCCTGACATCCCTAGG + Intergenic
953055913 3:39387082-39387104 CTTGAAATGCTCTCTTCCTTTGG - Intronic
953391784 3:42538146-42538168 GTTCCCATGCTGACCTCCTTGGG + Intergenic
956031367 3:65041321-65041343 TTTGACATGGTGTGATCATTTGG - Intergenic
956391241 3:68775047-68775069 GTTAACATCCTCACATCCTTTGG - Intronic
960709352 3:120511768-120511790 TTTTACATGCTGGCATACTTTGG - Intergenic
960941458 3:122937683-122937705 GTTGACCTGGTGTCAGCCTGGGG - Intronic
964697604 3:159527094-159527116 GTTCAGATGCCCTCATCCTTAGG + Intronic
965998154 3:174912268-174912290 GTTGACATTCCATCTTCCTTAGG - Intronic
966261058 3:177979843-177979865 GTTGGCATGATGTCATAATTTGG - Intergenic
967336872 3:188353729-188353751 GTTTAAATGCTGTTATGCTTTGG + Intronic
967879115 3:194286768-194286790 GTTGACATTTTTTCATCCCTGGG + Intergenic
970861611 4:20710158-20710180 GTTGACATGATGTGTTTCTTAGG + Intronic
976092245 4:81471125-81471147 GGTGATGTGCTGTCATCCTTCGG - Intronic
977976026 4:103268173-103268195 GGTGACCTGGTGTGATCCTTTGG + Intergenic
978464642 4:108995063-108995085 GGTGACCAGCTGTGATCCTTTGG - Intronic
984531816 4:180924990-180925012 GTTGAAATACTCTCTTCCTTAGG + Intergenic
986242065 5:5970113-5970135 ATTGACAAGCTCTCATCCCTTGG + Intergenic
989585486 5:43071288-43071310 GTTAACACGCTGACATCTTTCGG + Intronic
996538617 5:124605624-124605646 GTTGACATGATCTCATTCATGGG - Intergenic
998274790 5:140742271-140742293 GCGGACATTCTGTGATCCTTGGG - Intergenic
1002940328 6:1710127-1710149 GTTGACAAGCAGTGATTCTTGGG - Intronic
1003889638 6:10552517-10552539 GTTGTTATGCTGTATTCCTTAGG - Intronic
1005163003 6:22886796-22886818 GTTAATATGCAGTCAGCCTTGGG - Intergenic
1006252689 6:32802403-32802425 GTTTACAAGATGTTATCCTTGGG - Intergenic
1006817665 6:36863832-36863854 CTTGAGTTGCTGTCTTCCTTTGG + Intronic
1008318216 6:50073330-50073352 GTTGAGATGGTGTCATTATTAGG - Intergenic
1010364350 6:75031928-75031950 GGTGAGAAGCTGTGATCCTTTGG - Intergenic
1011336879 6:86271566-86271588 GTTGAGGAGCTGTGATCCTTTGG + Intergenic
1014128977 6:117810045-117810067 GTTGAGGAGCTGTGATCCTTTGG + Intergenic
1015869266 6:137759674-137759696 GTTGTCATGCTCTGGTCCTTGGG - Intergenic
1018112857 6:160552530-160552552 GTATACATGCTATGATCCTTTGG - Intronic
1018769939 6:166961753-166961775 GTTGCCATCTTGTCATCCATGGG + Intergenic
1022331404 7:29382740-29382762 GCTGAAATGCTGCCATCCTGGGG - Intronic
1026927662 7:74205101-74205123 GTTGACATGCTCTTACCCTAGGG - Intronic
1031469198 7:122148800-122148822 CTTGACTTGATGTCATCCATAGG - Intergenic
1036446954 8:8829762-8829784 TTTAACTTGCTGTCATCCATTGG - Intronic
1039343063 8:36672365-36672387 GGTGACATCCTGCCCTCCTTCGG + Intergenic
1043765557 8:84127349-84127371 GGTAAAATGCTGTCATCCCTGGG - Intergenic
1043880269 8:85534806-85534828 GTTGACATTTTATCATTCTTAGG + Intergenic
1047073598 8:121375440-121375462 ATTCACATGCTATCATGCTTCGG - Intergenic
1050286356 9:4106452-4106474 GTTTACAATTTGTCATCCTTGGG + Intronic
1057381894 9:94576139-94576161 GTTGAGATGATGTCAGCCTGAGG + Intronic
1058497052 9:105569892-105569914 GATGATATGCTGTCTTCTTTAGG + Intronic
1059710522 9:116863674-116863696 AATGACCTGCTGTCTTCCTTCGG - Exonic
1060133839 9:121132678-121132700 GGTGAGAAGCTGCCATCCTTTGG + Intronic
1060235773 9:121861707-121861729 GTTGACATGCTGTCATCCTTGGG - Intronic
1186102224 X:6169175-6169197 GGTGACATGATCTTATCCTTTGG - Intronic
1186192822 X:7082782-7082804 TTTGGCATGCTGTCTTTCTTAGG + Intronic
1186338320 X:8616267-8616289 GTTGAAAAGCTTTCATCGTTTGG + Intronic
1187404712 X:18992831-18992853 ATCAACATGTTGTCATCCTTTGG - Intronic
1188130606 X:26426771-26426793 TTTGAAATGCTGTCATCACTTGG - Intergenic
1190718192 X:53122205-53122227 TTTCACATGCTCCCATCCTTTGG + Intergenic
1191051289 X:56195178-56195200 GTTGAGGAGCTGTGATCCTTTGG - Intergenic
1191984952 X:66969553-66969575 GGTGACAAGTTGTTATCCTTTGG - Intergenic
1193281409 X:79655480-79655502 GGTGAGAAGCTGTGATCCTTTGG + Intergenic
1193722207 X:85000328-85000350 GTTCACATGCTCTCATCATTTGG + Intergenic
1199981191 X:152921376-152921398 GTTGGCATGCTGTCTTCTCTTGG - Intronic
1201564657 Y:15353565-15353587 CTTGGCATGCTGTCTTTCTTAGG + Intergenic