ID: 1060238238

View in Genome Browser
Species Human (GRCh38)
Location 9:121881687-121881709
Sequence GATTTGCACTGATGCGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060238237_1060238238 -10 Left 1060238237 9:121881674-121881696 CCATTCTGTATGGGATTTGCACT 0: 1
1: 0
2: 0
3: 14
4: 178
Right 1060238238 9:121881687-121881709 GATTTGCACTGATGCGAATGAGG No data
1060238233_1060238238 16 Left 1060238233 9:121881648-121881670 CCACTTTCCAAAGCAATTTTTGA 0: 1
1: 0
2: 1
3: 37
4: 410
Right 1060238238 9:121881687-121881709 GATTTGCACTGATGCGAATGAGG No data
1060238234_1060238238 9 Left 1060238234 9:121881655-121881677 CCAAAGCAATTTTTGAGTGCCAT 0: 1
1: 0
2: 0
3: 9
4: 178
Right 1060238238 9:121881687-121881709 GATTTGCACTGATGCGAATGAGG No data
1060238232_1060238238 17 Left 1060238232 9:121881647-121881669 CCCACTTTCCAAAGCAATTTTTG 0: 1
1: 0
2: 1
3: 38
4: 402
Right 1060238238 9:121881687-121881709 GATTTGCACTGATGCGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060238238 Original CRISPR GATTTGCACTGATGCGAATG AGG Intronic
No off target data available for this crispr