ID: 1060238548

View in Genome Browser
Species Human (GRCh38)
Location 9:121884146-121884168
Sequence CTCTGGGAGGGGGAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76742
Summary {0: 1, 1: 2, 2: 251, 3: 5829, 4: 70659}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060238548_1060238563 18 Left 1060238548 9:121884146-121884168 CCATCCACCTCCCCCTCCCAGAG 0: 1
1: 2
2: 251
3: 5829
4: 70659
Right 1060238563 9:121884187-121884209 GTGTGTTTATGGCGACACAATGG No data
1060238548_1060238557 -9 Left 1060238548 9:121884146-121884168 CCATCCACCTCCCCCTCCCAGAG 0: 1
1: 2
2: 251
3: 5829
4: 70659
Right 1060238557 9:121884160-121884182 CTCCCAGAGGGACAGCCCTAAGG No data
1060238548_1060238562 7 Left 1060238548 9:121884146-121884168 CCATCCACCTCCCCCTCCCAGAG 0: 1
1: 2
2: 251
3: 5829
4: 70659
Right 1060238562 9:121884176-121884198 CCTAAGGAGCAGTGTGTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060238548 Original CRISPR CTCTGGGAGGGGGAGGTGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr