ID: 1060245355

View in Genome Browser
Species Human (GRCh38)
Location 9:121941455-121941477
Sequence AAAGTCAACCTGTCTAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060245354_1060245355 8 Left 1060245354 9:121941424-121941446 CCGACATTTGCGGAGCATTGACA 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1060245355 9:121941455-121941477 AAAGTCAACCTGTCTAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060245355 Original CRISPR AAAGTCAACCTGTCTAAAAC TGG Intronic
No off target data available for this crispr