ID: 1060246521

View in Genome Browser
Species Human (GRCh38)
Location 9:121951006-121951028
Sequence GAGTGTGCCCAGAAAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 317}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060246521_1060246528 30 Left 1060246521 9:121951006-121951028 CCATCTTCTTTCTGGGCACACTC 0: 1
1: 0
2: 3
3: 22
4: 317
Right 1060246528 9:121951059-121951081 TGTCCTGTAAAGCCTGATGGCGG No data
1060246521_1060246524 -3 Left 1060246521 9:121951006-121951028 CCATCTTCTTTCTGGGCACACTC 0: 1
1: 0
2: 3
3: 22
4: 317
Right 1060246524 9:121951026-121951048 CTCACTGCCAGGGCTGCCTCTGG No data
1060246521_1060246527 27 Left 1060246521 9:121951006-121951028 CCATCTTCTTTCTGGGCACACTC 0: 1
1: 0
2: 3
3: 22
4: 317
Right 1060246527 9:121951056-121951078 AGCTGTCCTGTAAAGCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060246521 Original CRISPR GAGTGTGCCCAGAAAGAAGA TGG (reversed) Intronic
901025305 1:6275982-6276004 CAGTGTGCCCAGGAAGCAGTGGG + Intronic
901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG + Intronic
902280016 1:15367536-15367558 GAGTGTGCTCAAGGAGAAGATGG + Exonic
902479419 1:16703918-16703940 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
903241406 1:21984989-21985011 GACTGTGCCCAGAACAATGATGG - Intronic
903244865 1:22007861-22007883 GACTGTGCCCAGAACAATGATGG - Intronic
903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG + Intronic
904072431 1:27811794-27811816 GAGAGTGCCCTGGAAGATGATGG + Intronic
904443457 1:30548813-30548835 AAGTGAGCCTAGAAAGTAGAAGG - Intergenic
905871340 1:41406306-41406328 GAGAGTGCCCAGAAAAATGATGG + Intergenic
906029829 1:42709823-42709845 GAGTTAGCTGAGAAAGAAGAAGG - Intergenic
906280156 1:44547586-44547608 AAGTGTGCACCGAGAGAAGAGGG - Intronic
906926300 1:50120871-50120893 ATGTGTGGCCAGAGAGAAGATGG + Intronic
907514304 1:54983593-54983615 GAGTGAGCCCAAAAAGGTGAAGG - Intronic
908801472 1:67885034-67885056 GAGGGTGCCCACAGAGGAGATGG + Intergenic
909352012 1:74665152-74665174 GTGAGGGCCCAGCAAGAAGATGG + Intronic
910863851 1:91769411-91769433 GTGTGTGCCCAGAGAGAAGTTGG - Intronic
910916589 1:92296243-92296265 GTGTGTACCTAGAAGGAAGATGG + Intronic
911794026 1:102054187-102054209 CATTATGCCCAGGAAGAAGATGG + Intergenic
912285589 1:108365157-108365179 GAGTGGGAGCAGAAAGAGGAAGG - Intergenic
918194820 1:182211457-182211479 GTGTTTGCCCAGGAAGAAGAGGG - Intergenic
920088223 1:203433415-203433437 GCGTGAGCCCAGAATGATGAAGG + Intergenic
921670185 1:217916427-217916449 GAGAGTGCCCAGAACACAGAAGG + Intergenic
921956720 1:220992696-220992718 TAGTTTGTCCAAAAAGAAGAAGG - Intergenic
923754052 1:236773966-236773988 GATTGTGGCCAGAAAGGAGGAGG + Intergenic
924028919 1:239867351-239867373 GAGTGTGCCCACTAGGAATAGGG + Intronic
924646027 1:245878005-245878027 GAGTGTTCCCAGGAGGAGGAAGG + Intronic
1063077507 10:2731707-2731729 GGGTGTGCAAAGAAAGTAGATGG - Intergenic
1063532212 10:6844487-6844509 GAGGCTGCACAGAAAGCAGAAGG + Intergenic
1064120008 10:12610383-12610405 GAATGTGCCCAGAGAAAGGAGGG - Intronic
1067203203 10:44192684-44192706 GAGAGTGTCCAGACAGAAGATGG - Intergenic
1067787358 10:49260255-49260277 GAGGGTGCCGAGAAGAAAGAGGG + Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1069313222 10:67065515-67065537 CTGTGGGCCCAGGAAGAAGATGG - Intronic
1072079908 10:92018651-92018673 AAGTTTGCCGAGCAAGAAGAGGG + Intronic
1072795617 10:98352266-98352288 GTCTGAGCCCAGGAAGAAGAGGG + Intergenic
1073035029 10:100558119-100558141 GAGAGTCTCAAGAAAGAAGATGG + Exonic
1073099868 10:101000732-101000754 GAGTGGGCCCAGAGAGGGGAGGG + Exonic
1074121048 10:110494829-110494851 GAAGGTGCCCAGAAAGCAGAAGG - Intergenic
1075017613 10:118921832-118921854 TAGTGGGCCTAGAAAGAACAAGG + Intergenic
1075897268 10:126007878-126007900 CAGTGTGCCCAGTAATCAGATGG - Intronic
1076294513 10:129374210-129374232 CAGTGTGAACAGAAAGCAGAGGG - Intergenic
1076636028 10:131882434-131882456 GAGTGTGCCCTGGAAGGAGGCGG - Intergenic
1076682493 10:132180405-132180427 GACAGTGCCCAGAAAGGGGAGGG + Intronic
1077735552 11:4786848-4786870 AACTGTGCTCAGAAGGAAGAAGG - Intronic
1079184808 11:18227347-18227369 GAATATGCCTAAAAAGAAGATGG + Intronic
1079911423 11:26315331-26315353 GAGTGCTGCCAGAAACAAGATGG - Intronic
1081322543 11:41708747-41708769 GTATGTGCCCAGGAAGAAAAAGG - Intergenic
1082239383 11:49855040-49855062 GAGTGAGCCCAGAGAGACCAGGG - Intergenic
1082242764 11:49889312-49889334 GAGTGAGCCCAGAGAGACCAGGG + Intergenic
1083336074 11:61922637-61922659 GAGGCTAACCAGAAAGAAGAGGG - Intergenic
1083994004 11:66263295-66263317 GAGTTTGCCCAAACACAAGAGGG + Intronic
1084154533 11:67306309-67306331 CACTGTGCCCAGCAAGAAGGAGG - Intronic
1087272789 11:96128511-96128533 GTGTGTGTCAAGCAAGAAGATGG - Intronic
1088164054 11:106910565-106910587 GCCTGTGCCTAGAAAGAAGCGGG - Intronic
1089637246 11:119822969-119822991 GAGTGTTTCCAGAAGGAAGGGGG + Intergenic
1089943375 11:122442171-122442193 GAGTTTGACTAGTAAGAAGAGGG - Intergenic
1090590567 11:128262544-128262566 GAGGATGCACAGAGAGAAGACGG - Intergenic
1091449439 12:563213-563235 GAGTGGTCCCAGAAAGAAACTGG - Exonic
1091701763 12:2667984-2668006 GTGTGTGCTGGGAAAGAAGAGGG + Intronic
1091916213 12:4273119-4273141 GTGTGTGCAGAGGAAGAAGAGGG - Intergenic
1093149188 12:15601698-15601720 GAGAGAGACAAGAAAGAAGAGGG - Intergenic
1094061409 12:26318517-26318539 GATTGTTTCCAGAAAGAAAAAGG + Intergenic
1094352898 12:29546292-29546314 GAGGGTGGCCAGAAAGCTGAGGG + Intronic
1096400651 12:51303511-51303533 GAGGGTTCAGAGAAAGAAGAAGG - Intronic
1098244098 12:68498784-68498806 GAGTAAGCCAAGAAAAAAGAAGG - Intergenic
1099746448 12:86710208-86710230 GAATGTGCAAAAAAAGAAGAGGG - Intronic
1101382243 12:104224195-104224217 GAGTTTGCCCAGCAAAGAGAAGG - Intronic
1101717239 12:107321337-107321359 GAGTGTGCGCAGGAACAAGCGGG + Intronic
1102297630 12:111749204-111749226 GCGTGTGCCCAAAGAGAACATGG + Exonic
1102356504 12:112241294-112241316 CAGGGTGCCCAGAAAGAAATAGG - Intronic
1102531733 12:113551666-113551688 GGGTGGGCACAGAAGGAAGAAGG - Intergenic
1102955282 12:117054801-117054823 GAGGATGGCCAGAAAGAGGAAGG - Intronic
1103967648 12:124650238-124650260 GACTGTGGTCAGAAAGAAGGAGG + Intergenic
1104552967 12:129774315-129774337 GGGTGGGCCCAGGAAGTAGAGGG - Intronic
1104772910 12:131375446-131375468 CACTGTGCCCAGAAGGAAGATGG - Intergenic
1106061006 13:26291877-26291899 GAGTAAACCCAGAAAGATGATGG - Intronic
1106765904 13:32913731-32913753 GAGTGTCCCCAGGAAGAACCTGG - Intergenic
1107391209 13:39966261-39966283 TGATGTGCCCAGAAAGAAGGGGG + Intergenic
1107872292 13:44758670-44758692 GTGTGTGCACACAAAGGAGAGGG + Intergenic
1107982347 13:45745662-45745684 GAGTTTTCCAATAAAGAAGATGG - Intergenic
1108037816 13:46310024-46310046 GAGTAAGCCAAGAAAGAGGAAGG - Intergenic
1111396100 13:87671958-87671980 CAGTGTGCGCTGCAAGAAGAAGG + Intergenic
1112237776 13:97651725-97651747 TAGTGTGCCCAGGGATAAGATGG + Intergenic
1112555391 13:100463372-100463394 GAGTAGGCAAAGAAAGAAGAGGG + Intronic
1112928063 13:104701717-104701739 GGGTCTGTCCAGGAAGAAGATGG - Intergenic
1112981886 13:105394837-105394859 AAGTGTTCCCCGAAAGTAGAGGG + Intergenic
1113537801 13:111082023-111082045 GAGTGGGCTCACAAAAAAGAAGG - Intergenic
1114732111 14:25004122-25004144 GAGATTGCCAAAAAAGAAGAAGG + Intronic
1115960848 14:38835454-38835476 GAGCGTGCCCAGAGAGGAGAAGG + Intergenic
1117950639 14:61079822-61079844 GAGTGTGCCCTGAACAACGAAGG + Intronic
1118082908 14:62382269-62382291 GAGTGTGCCCTGCAATGAGATGG + Intergenic
1118675792 14:68183397-68183419 CAGTGTGGCTAGAAAGAAGCAGG - Intronic
1120265552 14:82245494-82245516 GATTGTTCCTAGAAAGCAGATGG + Intergenic
1122868915 14:104625127-104625149 GAGGCTGCCCAGGAAGAACAAGG + Intergenic
1124362069 15:29044961-29044983 GTGTGGACACAGAAAGAAGATGG - Intronic
1124372068 15:29109684-29109706 GCTGGTGCCCAGAACGAAGAGGG + Intronic
1124506275 15:30277301-30277323 GATGGTGCCAAGAAAAAAGAGGG + Intergenic
1124737281 15:32261335-32261357 GATGGTGCCAAGAAAAAAGAGGG - Intergenic
1126261366 15:46696639-46696661 TAGAGTGACCAGAGAGAAGAGGG - Intergenic
1127303430 15:57679826-57679848 GAGTGTGCCCAGAAGGCTGTGGG - Intronic
1128258407 15:66214858-66214880 GAGTGTGTGTGGAAAGAAGATGG + Intronic
1129828262 15:78650034-78650056 GAGTGTGCCCAGGAGGAGGATGG + Intronic
1130081646 15:80739062-80739084 AAGAGTGCCCAGAAAGAGCAGGG + Intronic
1130143602 15:81254357-81254379 GAATGGACCCAGAATGAAGATGG - Intronic
1130577604 15:85106261-85106283 GAGTGGGGGCAGAAAGGAGATGG - Intronic
1131298194 15:91170945-91170967 GAGTGAGTCCACAATGAAGAGGG - Intronic
1131387911 15:92022822-92022844 GAGGCTTCCCAGGAAGAAGAAGG + Intronic
1131734779 15:95320395-95320417 TGGTGTGCCCAGAAAGAGAATGG - Intergenic
1131953073 15:97702701-97702723 GAGAGTGTTGAGAAAGAAGACGG - Intergenic
1132065020 15:98723915-98723937 TAGTGTGCCCAGAAGCCAGAAGG + Intronic
1133526885 16:6614391-6614413 GTATCTGCCTAGAAAGAAGATGG + Intronic
1133846027 16:9454583-9454605 CAGGGTGCCAAGAAAGGAGATGG - Intergenic
1136615064 16:31393546-31393568 GAGTGTGACCTGAATGAAGAGGG + Intronic
1138404931 16:56783834-56783856 GAATATTCCCAGAAAGAAAATGG + Intronic
1139549264 16:67664458-67664480 GAGTGTGTCCAGGAAGCAGATGG - Intronic
1139921182 16:70461516-70461538 GAGAGTGCCCTGGAGGAAGATGG + Intronic
1140947152 16:79779604-79779626 GAGATTGCCCAGAAAGAGAAAGG - Intergenic
1141337878 16:83174325-83174347 GATAGTGCCAAGTAAGAAGATGG - Intronic
1142993447 17:3747104-3747126 GACTGTTCCCAGAAAGGAGGTGG - Intronic
1143970138 17:10789481-10789503 TCCTGTGCCCAGAGAGAAGATGG + Intergenic
1144135909 17:12294336-12294358 GATTATGCCCAGAAACAACAGGG - Intergenic
1150580463 17:66469116-66469138 GAATGTGGACAGAAAGAGGAAGG - Intronic
1152458118 17:80427633-80427655 GAGTGAGCTCAGGAAGAAAATGG - Intronic
1203166366 17_GL000205v2_random:100425-100447 GAGAGTGCCCAAGAATAAGAGGG + Intergenic
1154383571 18:13873309-13873331 CAGTGTGCCCAGGAAGGAAAGGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156481905 18:37441630-37441652 GAGGGTGACCACAAAGCAGATGG - Intronic
1156503918 18:37577193-37577215 GAGTGAGCCCAGAAGGGAAAGGG - Intergenic
1157550805 18:48580691-48580713 CAGAGTACCCAGAAAGACGACGG - Intronic
1158692164 18:59670508-59670530 GCGTGTGCCCAGTAATAGGACGG + Intronic
1159728101 18:71989092-71989114 GTGTGTTCTCAGAAAGAAAAGGG - Intergenic
1160354619 18:78216440-78216462 GACTGTCCCTAGAAAGAAAAAGG - Intergenic
1164817948 19:31220808-31220830 CTGTGTGCTCAGAAAGATGAAGG + Intergenic
1165109641 19:33494187-33494209 GGGGGTGCTCAGAAACAAGAGGG - Intronic
1165418491 19:35710413-35710435 GAGTCAGCCCAGGAAGAGGAAGG + Intronic
1166310074 19:41957866-41957888 GGGTGTGACCAGAAAGAACTTGG - Intronic
1166539120 19:43594029-43594051 AAGTGGGCACAGAAACAAGAGGG + Intronic
1166556061 19:43700457-43700479 GATTGGGCCCACACAGAAGAGGG - Intergenic
1166792729 19:45407381-45407403 GAGTGTCCTCAGAAAGCAGGGGG + Intronic
1167472337 19:49682258-49682280 CGGTGAGCCCAGAAAGAGGATGG + Exonic
1202713458 1_KI270714v1_random:29824-29846 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
924985139 2:264015-264037 GAGGCTGCCCAGGAAGAGGAAGG + Exonic
925828469 2:7873690-7873712 GAGTATGACTAGACAGAAGATGG + Intergenic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
928644371 2:33336217-33336239 GAGTTTGCCCACTATGAAGATGG - Intronic
928775923 2:34763337-34763359 GAGTGTGCCTAGAAAACTGATGG - Intergenic
929031076 2:37650315-37650337 CAGTGAGCCCAGGAAGCAGAAGG - Intronic
931547806 2:63408488-63408510 GGGGGTGGCCAGAAGGAAGACGG + Intronic
931865781 2:66409641-66409663 GAATATGCCCAAAAAGAAGAGGG + Intergenic
932103617 2:68923544-68923566 GAGTGGGGCCAGATGGAAGACGG - Intergenic
933010442 2:77055324-77055346 ACGTGTGCCCAGAAAGAGCAAGG - Intronic
934606934 2:95702599-95702621 GAGGGAGTCAAGAAAGAAGAGGG + Intergenic
935463655 2:103368788-103368810 GTGAGTACCCAGAAATAAGATGG - Intergenic
935865547 2:107383965-107383987 TGCTGTGCACAGAAAGAAGACGG - Intergenic
936441862 2:112561082-112561104 GAGAGTGGCCTGTAAGAAGAGGG + Intronic
936540327 2:113344723-113344745 GAGGGAGTCAAGAAAGAAGAGGG + Intergenic
936625180 2:114141098-114141120 GAGACTGCCCAGGAAGAAGAGGG - Intergenic
937103060 2:119286466-119286488 TGGTGTGCCCAGAGAGAACAGGG + Intergenic
937644647 2:124252473-124252495 GAGAGGGCTCAGAAAAAAGATGG - Intronic
938597283 2:132800942-132800964 CCGTGCCCCCAGAAAGAAGAGGG - Intronic
938786823 2:134637358-134637380 GAGTGTGCCCTGAGATGAGATGG + Intronic
940399577 2:153232456-153232478 GAGTGTGTTCTAAAAGAAGAAGG - Intergenic
941493912 2:166177328-166177350 GTGTGTGCCCAGAATGAAAAAGG - Intergenic
941710687 2:168709523-168709545 GAGTATGTCCAGAAACAATATGG + Intronic
942447154 2:176085657-176085679 GTGTGTCGGCAGAAAGAAGAGGG - Intergenic
943374326 2:187055824-187055846 GAGTGCCCACAGAAAGAAGTTGG - Intergenic
943807942 2:192147065-192147087 GAGTGACCCAAGAAAGCAGAAGG - Intronic
944354015 2:198763569-198763591 GAGTGTGTGCAGAAGGGAGATGG - Intergenic
944656950 2:201885006-201885028 GAGTGGGCCTTGAAAGATGATGG + Intronic
944875756 2:203962887-203962909 GAGTGTGACTAGACAGAAGATGG + Intergenic
946494437 2:220181578-220181600 GAATGTACCCAGAAACAACAAGG - Intergenic
948231210 2:236350891-236350913 AGGTCTGGCCAGAAAGAAGATGG + Intronic
1170519464 20:17169019-17169041 GAGTGTGCCCAGCATGTACAGGG - Intergenic
1170943849 20:20871966-20871988 GAATGTGCCAAAAAAAAAGAAGG + Intergenic
1171331578 20:24343791-24343813 GATTCTGTCAAGAAAGAAGAGGG - Intergenic
1171938713 20:31302983-31303005 AGGTGTGCCTAGAAAGGAGAAGG - Intergenic
1172321529 20:33998819-33998841 GAGTGTGTGCAGAAAAAAGATGG + Intronic
1172442601 20:34976732-34976754 GGGGGTCCCCAGAAAGAGGATGG + Intronic
1172882941 20:38213429-38213451 CAGCGCGCCCAGAACGAAGAGGG - Exonic
1174080834 20:47969629-47969651 GGGTGTGGCCAGAATGAAGGCGG + Intergenic
1174686673 20:52462869-52462891 GAGTTTGCAGAGAAAGACGATGG - Intergenic
1174872305 20:54194439-54194461 GAGTGCCCCCAGAGAGAATAAGG + Intergenic
1174932510 20:54831183-54831205 GAGTTTTCCCAAAAATAAGAAGG + Intergenic
1175566839 20:59986520-59986542 GTGTGTCCCAGGAAAGAAGAGGG - Intronic
1176405389 21:6358671-6358693 GAGAGTGCCCAAGAATAAGAGGG - Intergenic
1176431768 21:6630432-6630454 GAGAGTGCCCAAGAATAAGAGGG + Intergenic
1178279329 21:31267249-31267271 GTCTCTGCCCAGAGAGAAGATGG + Intronic
1178463112 21:32821032-32821054 AAGTGTTATCAGAAAGAAGAGGG - Intergenic
1179164815 21:38927059-38927081 GAGTGTGTCCATAAAAGAGATGG - Intergenic
1179251672 21:39675787-39675809 GAGTGGGCCCAGCCAGGAGAGGG + Intergenic
1179455715 21:41498473-41498495 CAGCCTGACCAGAAAGAAGAAGG + Intronic
1180904567 22:19400041-19400063 GTGGGAGCCCAGAAAGGAGAAGG + Intronic
1181046758 22:20218289-20218311 GGGTGTGCCCAGACAGCAGGGGG + Intergenic
1181920155 22:26314408-26314430 CAGTGTGGCCAGCAAGAAGGGGG + Intronic
1182489694 22:30663162-30663184 GATGGTGCCCAGAAGAAAGAGGG - Exonic
1182748791 22:32625570-32625592 GAATGTGTGAAGAAAGAAGAAGG - Intronic
1183802490 22:40178760-40178782 GAGCGCGCGCAGAAAGGAGAGGG - Intronic
1184045837 22:41971726-41971748 GAGTGTGCCCCCACAGGAGACGG + Intergenic
950622063 3:14213762-14213784 GAGAGTTCCCAGGAAGGAGAGGG - Intergenic
951072762 3:18351539-18351561 GATTCTGTCCAGAAAGAGGAGGG - Intronic
951854118 3:27175802-27175824 GAGTGTGAGAAGAAAGAAAAAGG + Intronic
952416148 3:33093019-33093041 GTGTGTGCCCAGAAAGGATCAGG + Exonic
952503078 3:33982291-33982313 GAGTAGGCCAAGAAAGAGGAAGG - Intergenic
954296460 3:49677049-49677071 GAGGGTGGTCAGCAAGAAGATGG + Intronic
954608146 3:51929540-51929562 CAGTGTCCCCAGAAAGAGGTGGG + Intergenic
954697437 3:52435282-52435304 GGGTGTGCCCAGAGGCAAGAGGG - Exonic
955813289 3:62814968-62814990 GAGAGGGACCAAAAAGAAGACGG - Intronic
956858931 3:73303330-73303352 GAGACTGCCTAGAAATAAGAAGG - Intergenic
957421507 3:79977529-79977551 GAGTGTGGGGAGGAAGAAGATGG + Intergenic
959503539 3:107133529-107133551 GAGAGTGGCAAGAAAAAAGAGGG - Intergenic
961647847 3:128401909-128401931 GAGTCTGCCCAGGAAGGACAGGG - Intronic
962152971 3:132912476-132912498 GAGTGTGGCAGGCAAGAAGAAGG - Intergenic
964043005 3:152286226-152286248 GTGTGTGCCCCCAAAGAATAAGG - Intronic
965614000 3:170574520-170574542 CAGTGTGCTCAGGAAGAAAAAGG - Intronic
967369867 3:188731953-188731975 GAGTGAGCAAAGAAAGATGAGGG + Intronic
967677122 3:192314055-192314077 GTGAGTGCACAGCAAGAAGATGG + Intronic
967913265 3:194559257-194559279 GAGTATTGCCAGATAGAAGAAGG + Intergenic
969585107 4:8087155-8087177 GGGTGTCCCCAGACAGAGGAGGG - Intronic
971081463 4:23217099-23217121 TAATGTGCCTAGGAAGAAGATGG - Intergenic
973847799 4:54930876-54930898 GAATGTTCCCTGAAATAAGAAGG + Intergenic
974928828 4:68337128-68337150 GAGAGAGACCAGAAAGAGGAGGG - Exonic
975363735 4:73503434-73503456 GAATGTTGACAGAAAGAAGAGGG + Intronic
976229715 4:82828999-82829021 CAGAGTACCCAAAAAGAAGAAGG - Exonic
977285796 4:95105267-95105289 GTGTGTGCCAAGAGAGAAGTGGG + Intronic
977998008 4:103518025-103518047 GGGTGTGCATAGAAAGAATAAGG - Intergenic
978676092 4:111317918-111317940 GAGTGTCCCAAGAGATAAGATGG - Intergenic
980595882 4:134953230-134953252 AAGTATGCCCAGCAAGGAGAGGG + Intergenic
980610157 4:135150338-135150360 CTGTGTTCCCAGAAAGATGATGG - Intergenic
980639644 4:135560572-135560594 GTGTGTACCCAGAGAGAAGGAGG - Intergenic
981161389 4:141503244-141503266 GTGAGGGCCCAGAAAGAAGGTGG + Intergenic
982020569 4:151199612-151199634 CAGTGTGGCAGGAAAGAAGAGGG - Intronic
985206029 4:187538077-187538099 GTGTGTGGCCAGAAAGTAAAAGG - Intergenic
987973840 5:24985757-24985779 GAGTGTCCCCAGATAGAAACGGG + Intergenic
991144939 5:63290165-63290187 GAGAGTGGCAAGAAAGAAGAAGG - Intergenic
991174710 5:63673717-63673739 GAGTGAGACCAGAAAGGAGGAGG + Intergenic
991239485 5:64441260-64441282 GAATGTGACCAGATAGATGAGGG - Intergenic
991261978 5:64677386-64677408 GAGGCTGCCCAGAAGCAAGAGGG - Intergenic
992175092 5:74142229-74142251 GAGTGTGCCCTGAGATAGGATGG - Intergenic
992991148 5:82285118-82285140 GACAGAGCCCAGAAAGAACAGGG + Intronic
993980700 5:94540124-94540146 CAGTTTGCCCAGAGAGAAAAAGG - Intronic
994472739 5:100229597-100229619 AAATGTGGCAAGAAAGAAGAAGG - Intergenic
995679463 5:114700759-114700781 AAATGTGCACAGAAAGGAGATGG + Intergenic
996725261 5:126668738-126668760 GAGTATGACTAGACAGAAGATGG + Intergenic
997299143 5:132789645-132789667 GAGCATGCCGAGAAAGCAGATGG - Intronic
997880958 5:137589251-137589273 GAGTGTTTCCAGGAAGAGGAAGG + Intronic
998895954 5:146800417-146800439 GAGAGTGCCCTCCAAGAAGAAGG - Intronic
1000167760 5:158671757-158671779 GAGTGTTACCAAAAAGAAGTTGG + Intergenic
1000923452 5:167165490-167165512 TGGGGTGACCAGAAAGAAGAGGG + Intergenic
1001070366 5:168579801-168579823 GAGTGGTCCCAGCGAGAAGAGGG + Intergenic
1002087996 5:176787746-176787768 GAATGGTCCCAGAAGGAAGAGGG - Intergenic
1003461852 6:6336411-6336433 GAGTGTGTTCAGACAGAACAGGG - Intergenic
1003630952 6:7786716-7786738 GAGAATACACAGAAAGAAGAAGG + Intronic
1003651751 6:7967249-7967271 GAGAGGGCACTGAAAGAAGAGGG + Intronic
1004295222 6:14403981-14404003 GAGTGAGCACAGAATGAGGAAGG - Intergenic
1005131431 6:22513026-22513048 CAGTGAGCCAAGAGAGAAGATGG + Intergenic
1005750464 6:28877273-28877295 GAGCGTGCCCAGGAAAAAGCTGG - Intergenic
1005838858 6:29727118-29727140 GATGGTGCCAAGAACGAAGAAGG - Exonic
1007074767 6:39059451-39059473 AGGTGTGCCCAGACAGCAGAGGG - Intronic
1007222216 6:40287687-40287709 GATTGTGCCCAGACAGATTAAGG - Intergenic
1007404390 6:41625628-41625650 GAGTGTGAACAGAAAGAGGCTGG + Intergenic
1008050044 6:46891690-46891712 GTGTGTGCCTAGAAAGCACATGG + Intronic
1013866142 6:114698456-114698478 GAGAGTGGCCAGAATGCAGAAGG + Intergenic
1015556600 6:134468724-134468746 GAGTGTTCCCAGAAAGAGTGGGG - Intergenic
1016539140 6:145143549-145143571 GACTGTACCCAGAAATAAGCAGG - Intergenic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1017678269 6:156837716-156837738 GAGGGTGCAGAGGAAGAAGATGG + Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018178553 6:161200100-161200122 GAATGTGCACAGAAAGAGGAAGG + Intronic
1018379612 6:163246332-163246354 GAGAGTGTCCAGGCAGAAGAAGG - Intronic
1019543721 7:1562856-1562878 GAGCGGGCCCAGAAAGCAGAGGG + Intergenic
1020370572 7:7427849-7427871 AAGAGTGCCTAGATAGAAGACGG + Intronic
1020532353 7:9354392-9354414 GAGTATGACTAGACAGAAGACGG + Intergenic
1021287085 7:18793643-18793665 GAGTGTTCTCAGGCAGAAGAAGG - Intronic
1023862070 7:44222730-44222752 CACTGTGCCCAGCCAGAAGAGGG + Intronic
1023878757 7:44307002-44307024 GGGTGTGAGCAGGAAGAAGAGGG + Intronic
1024013566 7:45291465-45291487 GAGTTTTCCAAGAAAGAAGTGGG - Intergenic
1027476976 7:78644874-78644896 GACTGACCTCAGAAAGAAGAGGG + Intronic
1028655462 7:93200916-93200938 GAGTGTGCCCTGAAATGGGATGG - Intronic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1030069514 7:105686896-105686918 GAGTTGGCCCAGAAAGGAGGTGG + Intronic
1030460417 7:109827982-109828004 GATTGTGCCCACCCAGAAGAAGG + Intergenic
1030844591 7:114393467-114393489 GAGTCTGACCAGAGAGAGGAGGG + Intronic
1031014716 7:116560532-116560554 CCCTTTGCCCAGAAAGAAGATGG + Exonic
1031228233 7:119069709-119069731 CAGTGTGCCCAGAGAGAATTTGG - Intergenic
1032463173 7:132126634-132126656 GACTGTTCCCAGGAAGAAGCAGG - Exonic
1032802780 7:135329741-135329763 CTGTGTCCCCACAAAGAAGAGGG - Intergenic
1033004768 7:137549471-137549493 GTGTGTTCCCAGTAAGAAGAAGG - Intronic
1034262030 7:149763257-149763279 GTGTGTGCCCAGCAGGAAGGAGG - Intergenic
1036762997 8:11525109-11525131 GATTGAGCACTGAAAGAAGAGGG + Intronic
1037189150 8:16100611-16100633 GAGAGTGCACAGAACAAAGAAGG - Intergenic
1037974626 8:23200686-23200708 GAGTGTGTCCACAAAGAATCAGG - Exonic
1038152983 8:24958898-24958920 GAGGCTGCCCAGAAAGGAGAGGG + Intergenic
1038611576 8:29064232-29064254 AAGTTTGCCCAGAAAGCAGCAGG + Intronic
1039824525 8:41161732-41161754 GAGGGAGGCAAGAAAGAAGAAGG - Intergenic
1041468360 8:58180605-58180627 GAGTGGGGCCAGAGAGCAGAAGG + Intronic
1042077381 8:65011164-65011186 GACTTTGCCAAGAAAGAAAAAGG - Intergenic
1045030290 8:98128523-98128545 GAGATTGCCCAGAAAGAGGTAGG + Exonic
1046250392 8:111623789-111623811 GAGAGTCCCCACAAACAAGAAGG - Intergenic
1046827008 8:118702572-118702594 GATTGTGCAGAGAAAGAAGCTGG + Intergenic
1049215064 8:141404020-141404042 GAGTGTGCCCCGAGAGGGGATGG - Intronic
1049288966 8:141791586-141791608 GGGTGAGCCTAGAAAGAAAAGGG + Intergenic
1049549397 8:143249909-143249931 GAGTGCGCTCAGAGAGGAGAAGG + Exonic
1049703228 8:144024341-144024363 GAGAGGGTCCTGAAAGAAGAGGG - Intronic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1050648939 9:7754397-7754419 CACTGTGCCCAGGAGGAAGAAGG + Intergenic
1051086624 9:13357468-13357490 GGGTGTGACAAGAAAGAAAAAGG - Intergenic
1052513167 9:29447471-29447493 GAGTGAGAACAGGAAGAAGAGGG + Intergenic
1052736534 9:32348064-32348086 GAGTCAGCCCAGAAAGCAAAAGG - Intergenic
1053609082 9:39692740-39692762 GAAAGTGACCAGAAAGAATAAGG - Intergenic
1053695645 9:40637061-40637083 GATTGTGCCCACAAAGATTAAGG + Intergenic
1053942635 9:43268100-43268122 GATTGTGCCCACAAAGATTAAGG + Intergenic
1054089235 9:60778749-60778771 GAAAGTGACCAGAAAGAATAAGG + Intergenic
1054244443 9:62649658-62649680 GAAAGTGACCAGAAAGAATAAGG + Intergenic
1054306892 9:63436279-63436301 GATTGTGCCCACAAAGATTAAGG + Intergenic
1054405623 9:64760267-64760289 GATTGTGCCCACAAAGATTAAGG + Intergenic
1054439250 9:65245754-65245776 GATTGTGCCCACAAAGATTAAGG + Intergenic
1054491156 9:65776185-65776207 GATTGTGCCCACAAAGATTAAGG - Intergenic
1054558570 9:66684201-66684223 GAAAGTGACCAGAAAGAATAAGG + Intergenic
1059856396 9:118402760-118402782 GAGATGGCTCAGAAAGAAGAAGG + Intergenic
1060246521 9:121951006-121951028 GAGTGTGCCCAGAAAGAAGATGG - Intronic
1202778090 9_KI270717v1_random:10673-10695 GATTGTGCCCACAAAGATTAAGG + Intergenic
1203439771 Un_GL000195v1:178276-178298 GAGAGTGCCCAAGAATAAGAGGG - Intergenic
1185843033 X:3410905-3410927 GTGAGGGCCCAGAGAGAAGACGG - Intergenic
1186896433 X:14008863-14008885 GCGTGTACCCAAAAGGAAGAAGG + Exonic
1187344798 X:18453152-18453174 TTGTGTGACCAAAAAGAAGAGGG - Intronic
1188603003 X:31992583-31992605 GAGTGAGCCAAGAAAAACGAGGG - Intronic
1189142895 X:38625336-38625358 CTGTGTGCCTAGGAAGAAGATGG - Intronic
1189158980 X:38791134-38791156 GAATGTGAGCAGAGAGAAGATGG - Intergenic
1189430785 X:40945084-40945106 GGGTAAGCCCAGAATGAAGACGG + Intergenic
1193985918 X:88239582-88239604 AAGTGTTCTCAGAAAGAAGAAGG - Intergenic
1196070468 X:111515716-111515738 GAGTGTGCTTAGAAACAAGTGGG + Intergenic
1196433237 X:115650424-115650446 GAGTGTGCTCAGAACTTAGACGG + Exonic
1196665300 X:118309644-118309666 GAGGGTGCCTAGGAAGAAGAAGG - Intergenic
1197278578 X:124508830-124508852 GGGTCTGCCCAGAGAGAGGAGGG - Intronic
1197631781 X:128869308-128869330 GAGTGTTCCATGAAAGAAAAGGG + Intergenic
1197826357 X:130594530-130594552 AAGTGTGCAGAGACAGAAGAAGG + Intergenic
1198909890 X:141601675-141601697 GAGAGGGCCCAGAAATAGGATGG - Intronic
1198919846 X:141713238-141713260 GAATGTTCCCAGAAACAAGGAGG - Intergenic
1199534375 X:148885506-148885528 GAGTTTCCCATGAAAGAAGAGGG - Intronic
1199665526 X:150093617-150093639 GGCTGGGCCCTGAAAGAAGAAGG - Intergenic
1201232162 Y:11875670-11875692 GTGAGGGCCCAGAGAGAAGACGG + Intergenic
1201307103 Y:12560506-12560528 GAGTATGACTAGACAGAAGATGG + Intergenic