ID: 1060254015

View in Genome Browser
Species Human (GRCh38)
Location 9:122010583-122010605
Sequence TGTCCCTCCATTGCAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 295}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060254015 Original CRISPR TGTCCCTCCATTGCAGAGGA TGG (reversed) Intronic
900929791 1:5729301-5729323 TCTCCCTCCAGGGCAGAGGCAGG + Intergenic
901228129 1:7626354-7626376 TGCTCCTCCAGAGCAGAGGAAGG + Intronic
901310299 1:8264315-8264337 TGTCCCCACATTACAGAGAAGGG - Intergenic
902755381 1:18545947-18545969 TGTCCCTCCTTTCCAGTTGAGGG + Intergenic
903209867 1:21811887-21811909 TGTCCCCCCATAGCAGTGCACGG - Intergenic
903960887 1:27056999-27057021 TCTCACTCCATTGCAGAGGCTGG - Intergenic
905623932 1:39474357-39474379 TCTCCCTCTATTGCCTAGGACGG - Intronic
906466931 1:46090359-46090381 TCTCCCTCTATTGCTCAGGATGG + Intronic
907901344 1:58744173-58744195 TATCCCTCCATAGCAAAAGAAGG - Intergenic
911714906 1:101121323-101121345 TGCTCCTCTACTGCAGAGGAAGG + Intergenic
912275764 1:108256645-108256667 TCTCACTCCATTGCACAGGCTGG + Intergenic
912292463 1:108437709-108437731 TCTCACTCCATTGCACAGGCTGG - Intronic
912368792 1:109156849-109156871 TGTCCATCCATGGCAGAGGAAGG + Intronic
912624498 1:111196206-111196228 TCTCCCTCCCTGGCAGAGGCTGG + Intronic
913092820 1:115491404-115491426 TGTCCCGCCATTGCACTGGCTGG + Intergenic
913458196 1:119055610-119055632 TATCCCTCTATTGCTGAGGCTGG - Intronic
914715315 1:150249497-150249519 TATCCCTCCATTGCCCAGGCTGG - Intergenic
915411655 1:155705571-155705593 TCTCGCTCCATTGCCCAGGATGG - Intronic
916001377 1:160619665-160619687 TTTCCATCCAGAGCAGAGGAAGG - Intronic
917254394 1:173098853-173098875 TCTCCCTCCATTGCCCAGGATGG + Intergenic
918768522 1:188521051-188521073 TGTCTCTGCAATGGAGAGGACGG + Intergenic
919429754 1:197477850-197477872 AGTCTCTCCATTGCAGGGGGTGG - Exonic
921982485 1:221273668-221273690 TGTCACTCCACTGTAGAGGCAGG - Intergenic
924302660 1:242655303-242655325 TATCTCTCAATTACAGAGGATGG - Intergenic
1063996121 10:11621441-11621463 TCTCCCTCCATTGCCCAGGCTGG - Intergenic
1064165144 10:12979420-12979442 TGTCACTCCATTGCCCAGGCTGG + Intronic
1068781430 10:60922730-60922752 TGACCATCCCTTGCTGAGGATGG + Intronic
1069696344 10:70388334-70388356 TCTCCCTCCATTGCCCAGGCTGG - Intergenic
1070323561 10:75372973-75372995 AGTGCCTCCCTTCCAGAGGAAGG + Intergenic
1070613417 10:77950199-77950221 TGTCGCTCCATTGCCCAGGCTGG + Intergenic
1071130646 10:82389331-82389353 TGACCTTCCACTGCAGAGCAAGG - Intronic
1071256590 10:83877262-83877284 CATCCCTCCACTGCAGATGAGGG + Intergenic
1071291531 10:84192887-84192909 TTTCTCTGCTTTGCAGAGGAGGG - Intergenic
1071479913 10:86057387-86057409 TGTCTGGCCATTGCAGAAGAAGG - Intronic
1073834944 10:107430546-107430568 TGTCCCTACTGTCCAGAGGAGGG + Intergenic
1073868834 10:107837733-107837755 TCTCACTCCTTTGAAGAGGATGG + Intergenic
1074131555 10:110582959-110582981 TCTCACTCCATTGCACAGGCTGG + Intronic
1074148181 10:110735293-110735315 TATCCCCCCATTGCAGATAAGGG + Intronic
1074560767 10:114533309-114533331 TCTCCCTCCATTGCCCAGGCTGG - Intronic
1074897687 10:117791343-117791365 GGTCCCACCATGGCAGATGAGGG - Intergenic
1075708972 10:124520501-124520523 CCTGCCTCCATTGAAGAGGATGG + Intronic
1076408211 10:130227384-130227406 TGACCCTCCACTGGAGAGGCAGG + Intergenic
1076471648 10:130723255-130723277 TGTGCCTGAATTCCAGAGGAAGG + Intergenic
1077114982 11:880066-880088 TGTCCCTGCAATGCAGAGTGAGG - Intronic
1077152147 11:1077266-1077288 TGTCCCTCCACCCCAGAGGCCGG + Intergenic
1077169143 11:1158669-1158691 TGTCCCTCAGAAGCAGAGGAAGG - Intronic
1078626408 11:12962671-12962693 TTTCCTTGCACTGCAGAGGAGGG - Intergenic
1080192199 11:29564352-29564374 TGTCCTTTTATTGCAGATGAGGG + Intergenic
1080511770 11:32981920-32981942 TCTCCCTCCATTGCCCAGGCTGG + Intronic
1080826481 11:35853188-35853210 TCTCCCTCTATTGCCCAGGATGG + Intergenic
1080916752 11:36667646-36667668 TCTCGCTCCATTGCCGAGGCTGG - Intergenic
1081582161 11:44359832-44359854 AGTTCCTCCATTTCAGAGGCTGG - Intergenic
1084976915 11:72805940-72805962 TATCCCTCCATTGCCCAGGCTGG + Intergenic
1085620515 11:78034660-78034682 GGTCCCTTCAGTGCAGAGGTGGG + Intronic
1086162088 11:83733209-83733231 TCTCCCTCCATTGCCCAGGCTGG - Intronic
1088917315 11:114237472-114237494 CGTCTCTCCATAGCAGAGGACGG + Intronic
1089521142 11:119064485-119064507 TCTCCCTCCATTGCCCAGGCTGG - Intergenic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1090647181 11:128775782-128775804 TGTCCTTTCATTGGAGAGGAAGG + Intronic
1094304111 12:28998553-28998575 TTTCACCCCAATGCAGAGGAAGG - Intergenic
1094617806 12:32051944-32051966 TGTACCTCCAGTGAAAAGGATGG + Intergenic
1095055330 12:37591466-37591488 TGTCACTCTATTGCATAGGTTGG - Intergenic
1095765304 12:45887779-45887801 CGTCCTTCCAGTGCAGAGGCTGG + Intronic
1097282698 12:57854514-57854536 TATCCCTCCATTGCCCAGGCTGG + Intergenic
1098072426 12:66690113-66690135 TGTCCCTACATTGCCCAGGCTGG + Intronic
1100224438 12:92542038-92542060 GGTGCCTTCATTGCAGAGTAAGG - Intergenic
1100407116 12:94281247-94281269 TCTCCCTCCATTGCCCAGGCTGG - Intronic
1100638591 12:96459512-96459534 TCTCCCTCTATTGCCCAGGATGG + Intergenic
1102490568 12:113287645-113287667 TGTCCCGCCTTGGGAGAGGATGG - Intronic
1103363144 12:120365840-120365862 TGTCCCCACTTTGCAGATGAAGG - Intronic
1103690746 12:122772746-122772768 TGTCCCTCTATTGCCTAGGCTGG + Intergenic
1103792456 12:123481327-123481349 TCTCACTCCATTGCCGAGGCTGG - Intronic
1106488209 13:30191267-30191289 TCTCCCTCCCTGGTAGAGGATGG + Intergenic
1108187494 13:47902426-47902448 TGTCCTTACTTTGCAGATGAGGG - Intergenic
1110848604 13:80218454-80218476 TGGCCCTCCACTGCAGAGGGAGG - Intergenic
1111870744 13:93829058-93829080 TGTCCCTGCATTTCTGAGAAGGG + Intronic
1112356210 13:98676599-98676621 TGTCCCTGCTTTGCAGTGGCTGG - Intergenic
1112497222 13:99914878-99914900 TCTCCCTCTATTGCCCAGGATGG + Intergenic
1113632189 13:111895986-111896008 TGTCCGTGCAGTGCAGAGGGTGG - Intergenic
1116777217 14:49194811-49194833 TCTGCCTCCAGTGCTGAGGAGGG - Intergenic
1119806986 14:77488602-77488624 TTTCCCTAAATTACAGAGGAAGG - Intronic
1120267997 14:82275733-82275755 TGTGCCTAAATTCCAGAGGAAGG + Intergenic
1120481075 14:85050088-85050110 TTTCTCTACATTTCAGAGGAAGG - Intergenic
1120643491 14:87044102-87044124 TGTCCTTACATGGGAGAGGAGGG - Intergenic
1120711486 14:87797813-87797835 TGTCCCACTACTGGAGAGGAAGG - Intergenic
1122427894 14:101622394-101622416 TGTCCAGCCAATGCAGAGAACGG - Intergenic
1122987735 14:105220249-105220271 CGACCCACCAGTGCAGAGGAGGG - Intronic
1202833427 14_GL000009v2_random:59713-59735 TGGCACACCATTGCAGAGGTGGG + Intergenic
1123587431 15:21772631-21772653 TGTCCCTGCCCTGGAGAGGATGG + Intergenic
1123624069 15:22215196-22215218 TGTCCCTGCCCTGGAGAGGATGG + Intergenic
1124431876 15:29615183-29615205 TCTCCCTCCATTGCCCAGGCTGG + Intergenic
1124707484 15:31977792-31977814 TTTCCCTCCTTTGCGGAGGTGGG + Intergenic
1125460340 15:39900685-39900707 TGACCCACCATTCCAGAAGAAGG + Intronic
1127023974 15:54782052-54782074 TCTCCCTCCGTTGCCGAGGCTGG - Intergenic
1128992914 15:72275309-72275331 TCTCGCTCCATTGCTGAGGCTGG - Intronic
1129418648 15:75404728-75404750 TCTCACTCCATTGCTGAGGCTGG - Intronic
1129422648 15:75441487-75441509 TCTCCCTACATTGCACAGGCCGG + Intronic
1130785474 15:87091193-87091215 TGTGCATCCCTTGCAGATGATGG - Intergenic
1133244014 16:4434924-4434946 TCTCACTCCATTGCTGAGGCTGG + Intronic
1134203345 16:12217056-12217078 TGTCCCTTCATTGCCCAGGCTGG + Intronic
1135994661 16:27238897-27238919 TGTCACTCCATTGCCCAGGCTGG + Intronic
1138596544 16:58032248-58032270 TGGCCCTATTTTGCAGAGGAGGG + Intronic
1140023388 16:71261038-71261060 TCTCCCTCCATTGCTCAGGCTGG - Intergenic
1140969616 16:80000567-80000589 AGTGCCTCCACTGCAGAGGCTGG + Intergenic
1141159680 16:81620908-81620930 TTACCTTCCATTGCAGAGAATGG - Exonic
1141471271 16:84240179-84240201 TGCTCCTCCATGCCAGAGGAGGG - Intergenic
1141670792 16:85490719-85490741 TGTCCGTCAATAGAAGAGGAAGG + Intergenic
1143096474 17:4481001-4481023 TGCCCCTCCACTGCACAGAACGG - Intronic
1145813109 17:27776640-27776662 TCTCCCTCCATTGCCTAGGCTGG - Intronic
1148611594 17:48968287-48968309 TTTCCCTCCATTGCCCAGGCTGG + Intronic
1148762908 17:50017342-50017364 TCTCCCTCCATTGCCCAGGCTGG + Intergenic
1148879637 17:50716007-50716029 TGTCACTCCATTGCCCAGGCTGG + Intergenic
1150127832 17:62649927-62649949 TGTCGCTCTATTGCTGAGGTTGG + Intronic
1150132794 17:62678413-62678435 TTTCCCACCATGGCAGAGGAGGG - Intronic
1151082554 17:71345361-71345383 TGTCATTCCATGGCAGAAGATGG - Intergenic
1152207540 17:78982368-78982390 TCTCCCTCCATTGCCCAGGCTGG + Intergenic
1152983507 18:301373-301395 TGTCCCTACATTGCTAAGGCTGG + Intergenic
1153591828 18:6682652-6682674 TCTCCCTCCATTACAGGGAAAGG - Intergenic
1155990609 18:32275433-32275455 TTACCGTCCATTGCAGATGACGG + Intronic
1158037510 18:53051198-53051220 TGTCTCTCCATTGCCCAGGCTGG - Intronic
1158181201 18:54716525-54716547 TCTCACTCTATTGCTGAGGATGG - Intergenic
1159029509 18:63216712-63216734 CGTCTCTCCTGTGCAGAGGAAGG - Intronic
1161238894 19:3211006-3211028 TGTTCCTGGAGTGCAGAGGAGGG + Intergenic
1161412232 19:4123310-4123332 GGTCCCTGCAGTGCAGAAGATGG - Intronic
1161794971 19:6381253-6381275 GGTGCCTCCACTGCAGATGAGGG + Intronic
1161838792 19:6665962-6665984 TATCCCTGCTTTGCAGAGGAGGG + Intronic
1162452315 19:10762660-10762682 TGTCCCCACCTTACAGAGGAGGG + Intronic
1163450103 19:17372049-17372071 TGTCACTACATTGCCGAGGCTGG - Intronic
1163818449 19:19482372-19482394 TCTCCCTCTATTGCCCAGGATGG - Intronic
1166525241 19:43506559-43506581 TCTCCCTCCATTGCCCAGGCTGG - Intergenic
1166769839 19:45274841-45274863 TGTGCCTCCTTTGCACAGCAAGG - Intronic
1167921980 19:52789556-52789578 TCTCGCTCCATTGCCCAGGATGG - Intronic
1168304017 19:55424541-55424563 TGTTGCTCTATTGCAGAGGCTGG - Intergenic
1168700610 19:58437167-58437189 TGTCCCCACATTGAAGAGCATGG - Exonic
925162391 2:1695036-1695058 TGCTCCTCCAGAGCAGAGGATGG + Intronic
925164645 2:1708562-1708584 TGACCCACGATGGCAGAGGAAGG + Intronic
925213717 2:2073821-2073843 TGTCCCTCCATTTCCAAGGAAGG + Intronic
925622608 2:5808320-5808342 GGACCCTCCTTGGCAGAGGAAGG - Intergenic
925663082 2:6223394-6223416 GGTCCCTGCAGTGCAGAGGGGGG - Intergenic
926695351 2:15766833-15766855 TCTTCCTCAACTGCAGAGGAGGG + Intergenic
928118567 2:28565382-28565404 GGCCCCTTCATTGCAGAGCAAGG + Intronic
928243079 2:29603516-29603538 TGTGCCTGCATTCCAAAGGAAGG + Intronic
928419230 2:31124648-31124670 TCTCCCTCTATTGCCCAGGATGG + Intronic
929696520 2:44121284-44121306 TCTCCCTCCATTGCCCAGGCTGG - Intergenic
930876582 2:56225394-56225416 TCTCCTTCTATTGCACAGGATGG - Intronic
931657317 2:64521447-64521469 TCTCCCTCCATTGCGCAGGCTGG - Intergenic
933004425 2:76972445-76972467 TCTCCCTCTATTGCCCAGGATGG + Intronic
936666943 2:114607912-114607934 TGTCCATCCAGTGCAGGGGTTGG + Intronic
937190076 2:120086709-120086731 TCTCCCTCCATTACACAGGGTGG - Intronic
941244863 2:163084345-163084367 TTTGCCTCCATTGCATAGAAAGG + Intergenic
941714272 2:168747254-168747276 TCTCACTCCATTGCCCAGGATGG - Intronic
942194376 2:173503053-173503075 TGTCAGTCCTTTGCAGAAGAAGG + Intergenic
944140204 2:196448027-196448049 TCTCCCTCTATTGCCGAGGATGG - Intronic
945084276 2:206115453-206115475 TGTCCTCCCATGGCAGAAGATGG - Intronic
1169788629 20:9386221-9386243 TCTCCCTCCGTTGCCGAGGCTGG - Intronic
1170216733 20:13899543-13899565 TGTCCTTCCCTGGCAGAGGGTGG + Intronic
1170426970 20:16244719-16244741 TCTCCCTCTATTGCTGAGGCTGG - Intergenic
1171171397 20:23018410-23018432 AGTCCCTACCTTGCAGGGGAAGG + Intergenic
1171211479 20:23320551-23320573 TTTCCCTCTAGTGGAGAGGAAGG + Intergenic
1171282511 20:23912549-23912571 TGTGCCTCCAGGGCTGAGGAAGG + Intergenic
1172067162 20:32229798-32229820 TCTCACTCCATTGCCGAGGCTGG + Intronic
1172173645 20:32959728-32959750 TGTCCCCCCACTGCAAAGCAGGG - Intronic
1172753181 20:37265483-37265505 TGTCACTCCATTGCCCAGGCTGG - Intergenic
1174755971 20:53158731-53158753 TGTCCCTCCATGGTTGGGGAGGG - Intronic
1176251687 20:64124900-64124922 TCTCCCTCTATTGCCCAGGATGG + Intergenic
1177584103 21:23067901-23067923 TCTCACTCCATTGCACAGGTTGG + Intergenic
1179222729 21:39424040-39424062 TCTCCCTCCATTGCCCAGGCTGG + Intronic
1179297243 21:40074380-40074402 TGTCCTCACATTGCAGAGCAAGG + Intronic
1180837412 22:18936998-18937020 TCTCCCTCCATTGCCCAGGCTGG - Intergenic
1181362948 22:22352862-22352884 CTTCCCACCCTTGCAGAGGAGGG - Intergenic
1181377435 22:22471176-22471198 TCTCCCTCCATTGCCCAGGCTGG + Intergenic
1181589184 22:23872714-23872736 TGTCCCTCCTTCTTAGAGGAAGG + Intronic
1182363752 22:29764108-29764130 TCTCCCTCCATTGCCCAGGCTGG - Intronic
1182522437 22:30892066-30892088 ACTCCCTCCATCGCAGTGGAGGG - Intronic
1183021899 22:35034001-35034023 TGTCCATACGTGGCAGAGGAAGG - Intergenic
1183115084 22:35685669-35685691 TGCACCTCCTTTGCAGAGGTGGG - Intergenic
1184021940 22:41826804-41826826 TGCCCCTCCCAAGCAGAGGAGGG + Intergenic
1184342054 22:43891509-43891531 TGACCCCCATTTGCAGAGGAGGG - Intronic
1184790163 22:46695275-46695297 TGTCCCTTCATAGCAGTGGTGGG + Exonic
1185272357 22:49935264-49935286 GGTCCGCCCTTTGCAGAGGAAGG + Intergenic
1203287505 22_KI270734v1_random:162297-162319 TCTCCCTCCATTGCCCAGGCTGG - Intergenic
949298794 3:2559257-2559279 TACCCCACCATTGCAGAGAATGG + Intronic
949509228 3:4753884-4753906 TCTTTCTCCATTGCAGATGAGGG + Intronic
949757052 3:7424122-7424144 TATCCCTCCTTTACAGATGAGGG - Intronic
950141437 3:10618904-10618926 TGTCACTCCTTGGAAGAGGATGG - Intronic
950481037 3:13243909-13243931 TGTCTCCACTTTGCAGAGGAGGG - Intergenic
952234936 3:31469384-31469406 TATCCCTTCATTGCCAAGGACGG - Intergenic
952402805 3:32978534-32978556 TGTTCATCCATTGCAGAAAAGGG - Intergenic
954261403 3:49441636-49441658 TCTCACTCCATTGCTGAGGCTGG - Intergenic
954265540 3:49468390-49468412 TCTCCCTCTATTGCATAGGCTGG + Intergenic
954685335 3:52367071-52367093 TGTCCCCGCTTTGCAGACGAGGG - Intronic
954847691 3:53574247-53574269 GCTTCCTCCAGTGCAGAGGAAGG - Intronic
955281539 3:57598834-57598856 TGTATCTCCAATGCAAAGGAGGG - Intergenic
956800551 3:72754193-72754215 TATCCCTACATTACAGATGAGGG + Intronic
959114862 3:102164658-102164680 TTTTTCTCCATTGCAGAGCAAGG + Intronic
960268354 3:115647289-115647311 TTTCTCACCATTCCAGAGGATGG - Intronic
961692503 3:128680371-128680393 TGTCCCTCTGTTGCACAGGCTGG + Intronic
962922054 3:139959158-139959180 TGAGCCCCCCTTGCAGAGGATGG + Intronic
963669877 3:148237445-148237467 TCTCCCTCCATTGCCCAGGCTGG - Intergenic
965680640 3:171247839-171247861 TGTCCCTGCATTGCTGTGTAAGG - Intronic
966248977 3:177840646-177840668 TGACCCTCCTATTCAGAGGAAGG + Intergenic
966739564 3:183219579-183219601 TCTCACTCCATTGCACAGGCTGG - Intronic
967536781 3:190613801-190613823 TCTCCCTCCATTGCCCAGGCTGG - Intronic
967727878 3:192878932-192878954 TGTCCCTCCATAGCCCAGGCTGG - Intronic
967907324 3:194512445-194512467 TCTCCCTACATTGCACAGGCTGG - Intergenic
968152821 3:196352275-196352297 TCTCGCTCCATTGCCCAGGATGG + Exonic
970872172 4:20828598-20828620 TCCCATTCCATTGCAGAGGATGG - Intronic
971635564 4:29052636-29052658 TTTCACCCCATTGGAGAGGAAGG - Intergenic
972641836 4:40932624-40932646 TCTCTCTCCATGGCACAGGAGGG + Intronic
973032854 4:45365652-45365674 TGTCCTCCCATTGCAAAAGACGG + Intergenic
973640204 4:52895027-52895049 TTTCCCTCCAATCTAGAGGATGG - Intronic
974044209 4:56883952-56883974 TCTCCCTCCACTGCCCAGGATGG - Intergenic
975635024 4:76439647-76439669 TGACCCTCCATTGTAGGGGAAGG + Intronic
975810192 4:78159973-78159995 TTTCCCTCCATGGGAGAGAAAGG + Intronic
976151929 4:82101046-82101068 TCTCCCTACATTGCACAGGCTGG - Intergenic
976561878 4:86511359-86511381 TCTCCCTACATTGCACAGGCTGG - Intronic
980475189 4:133305138-133305160 TCTCACTCCATTGCATAGGCTGG + Intergenic
981425033 4:144593446-144593468 TGCCTCTCCTTTGCAGTGGAAGG + Intergenic
982838011 4:160147163-160147185 TGTTCCTCCCTTGAAGAGGTGGG + Intergenic
983276254 4:165621598-165621620 TCTCCCTCTGTTGCAGAAGATGG + Intergenic
1202766594 4_GL000008v2_random:153852-153874 TGGCACACCATTGCAGAGGTGGG - Intergenic
985527250 5:412748-412770 TCTCACTCCATTGCATAGGCTGG + Intronic
985730711 5:1546723-1546745 CGCCCCTGCTTTGCAGAGGATGG - Intergenic
986178509 5:5372233-5372255 TGTCCCTCAATGGCAGAACATGG + Intergenic
987428251 5:17798067-17798089 TATCCTTCCTTAGCAGAGGAAGG - Intergenic
987513640 5:18875813-18875835 TCTCACTCCATTGCACAGGCTGG - Intergenic
987698550 5:21364621-21364643 TGTGCCGCCATTTCAGAAGAAGG + Intergenic
988841584 5:35088630-35088652 TGTTCCTCTAATGCAGATGAAGG - Intronic
989843769 5:46113719-46113741 TCTCCCTCCATTGCCCAGGCTGG + Intergenic
989977779 5:50607495-50607517 TCTCCCTCCATTGCCAAGGCTGG + Intergenic
990097523 5:52135519-52135541 TTTCTCTCCATTCCAGAGGGTGG + Intergenic
990968076 5:61471366-61471388 TTTCCCTACATTGCATAGGAAGG - Intronic
992581217 5:78178589-78178611 TCTCACTCCATTGCACAGGCTGG - Intronic
992675749 5:79104248-79104270 TCTCCCTGCATTGCCCAGGATGG - Intronic
993273900 5:85831558-85831580 TTTCCCTCTATTGCCCAGGATGG - Intergenic
997724765 5:136111377-136111399 TCTCCCTACATTGCCCAGGATGG - Intergenic
998193906 5:140049829-140049851 TGTCCTTCTTTTACAGAGGAAGG + Intergenic
998646104 5:144064058-144064080 AGTCCCTGCATTGCAGAAGCTGG + Intergenic
1000081068 5:157847840-157847862 TCTCCCTCCATTGCCCAGGCCGG + Intronic
1002361828 5:178678227-178678249 TGTCTGTCCATAGCAGAGCATGG - Intergenic
1002432398 5:179211119-179211141 GGTCCCTCCAAGGCAGAAGAGGG + Intronic
1002841172 6:908680-908702 TGTCCCCACATGGCAGAGAAAGG - Intergenic
1002987252 6:2202535-2202557 CGTGCCTCAGTTGCAGAGGAGGG + Intronic
1004097932 6:12577795-12577817 TTTCCCTCCATTGCTGCGCAAGG + Intergenic
1004515798 6:16321421-16321443 TCACCCTCCACTGAAGAGGAAGG + Intronic
1005552279 6:26933757-26933779 TGTGCCGCCATTTCAGAAGAAGG - Intergenic
1005820685 6:29596107-29596129 TGTCCCTAAACTCCAGAGGAAGG - Intronic
1005901804 6:30222669-30222691 TCTCCCTCTGTTGCAGAGGCTGG - Intergenic
1007728276 6:43930038-43930060 TGTCTCGCCATTGCTGAGAAGGG - Intergenic
1008517654 6:52333257-52333279 TGTCACTCCATTGCCCAGGCTGG - Intergenic
1011714972 6:90096011-90096033 TCTCCCCACATTGTAGAGGAAGG - Intronic
1013053265 6:106558274-106558296 AGTTTCTCCATTGCATAGGAAGG - Intronic
1013151875 6:107454075-107454097 TATCACTCCATTGCCCAGGATGG + Intronic
1014344185 6:120246720-120246742 TGGCCATCAATTGCTGAGGAAGG - Intergenic
1014547586 6:122751365-122751387 TGTCCCTATATTGCAGGTGATGG + Intergenic
1018174763 6:161168897-161168919 TGTCCCTACTTTACAGAGAAGGG - Intronic
1018605204 6:165590281-165590303 ATTCCCTCCATTTTAGAGGATGG + Intronic
1019549850 7:1596608-1596630 TCTCCTGCCATTGCAGAGAATGG + Intergenic
1020514507 7:9099561-9099583 TCTCCCTACATTCCAGAGTAAGG - Intergenic
1020605011 7:10326413-10326435 TGTCCCTCCATTATAGAGGAGGG + Intergenic
1020605138 7:10327484-10327506 TGTCCCTCCATGATAAAGGAGGG + Intergenic
1021805458 7:24350277-24350299 TTTCCCTACATTGCACAGGCTGG - Intergenic
1021995848 7:26177565-26177587 TCTCCCTCCATTGCTGAGCCTGG - Intronic
1022326182 7:29334079-29334101 TCTCCCTCCATTGCCCAGGCTGG + Intronic
1022352094 7:29576024-29576046 TATCAGTCTATTGCAGAGGAAGG + Intergenic
1023381463 7:39612404-39612426 TCTCACTCCATTGCCCAGGATGG - Intergenic
1023568503 7:41548766-41548788 TGTCTCTCCATAGGAGAGGAAGG + Intergenic
1025144994 7:56494633-56494655 TCTGCCTCCTGTGCAGAGGAGGG + Intergenic
1025260581 7:57415088-57415110 TCTGCCTCCTGTGCAGAGGAAGG + Intergenic
1025753696 7:64314298-64314320 TTTCCCTCCATCGCAGATTAGGG + Intronic
1025796632 7:64743826-64743848 TCTCCCTCCATTGCCCAGGCTGG - Intergenic
1025927868 7:65973725-65973747 TCTCCCTCTATTGCCCAGGATGG - Intronic
1026927326 7:74203625-74203647 TGTCACTCCATTGCCCAGGCTGG - Intronic
1026962076 7:74415311-74415333 TATCCCTCCCTGGCAGTGGATGG - Intergenic
1027690359 7:81337473-81337495 TCTCCCTCCATTGCCCAGGCTGG + Intergenic
1027870048 7:83695312-83695334 TCTCCCTCCATGGCAGGGTATGG + Intergenic
1028602018 7:92611958-92611980 TGTCCCTCCTTTGAAGTGGATGG - Exonic
1030802465 7:113869016-113869038 TCTCACTCCATTGCTGAGGCTGG - Intergenic
1032209892 7:129903872-129903894 TGTCACTCTATTGCCGAGGCTGG - Intronic
1034527658 7:151675819-151675841 GGTCCCGCCATGGCAGAGGGAGG + Intronic
1036124725 8:6052332-6052354 AGGCCCTCCACTGCAGCGGATGG + Intergenic
1036685874 8:10909874-10909896 TGTCCCTATTTTTCAGAGGAAGG + Intronic
1036732227 8:11276026-11276048 TGTCCCCACCTTGCAGATGAGGG - Intergenic
1037643662 8:20771157-20771179 TGGCCCTCCTTTGCAGTGGGTGG + Intergenic
1037881217 8:22574376-22574398 TGTCCCCACTTTGCGGAGGAGGG + Intronic
1038781691 8:30573557-30573579 TGTCACTCTATTGAACAGGAAGG + Intergenic
1039799573 8:40942482-40942504 TTTGCTTCCATTGCAGAGGGTGG + Intergenic
1044701827 8:94972269-94972291 TCTCGCTCCATTGCAAAGGCTGG + Intronic
1045074353 8:98546655-98546677 CCTCACTCCACTGCAGAGGATGG - Intronic
1045426973 8:102077116-102077138 TGTCTCTCCTTTGCAGAGGCTGG + Intronic
1047700452 8:127444344-127444366 TGTGCCCTCATTGCAGTGGAAGG - Intergenic
1048276127 8:133067320-133067342 TTTCTCTACACTGCAGAGGAGGG + Intronic
1049955965 9:693333-693355 TAACCCTCCACTGCAGAGAAAGG - Intronic
1052427405 9:28323568-28323590 TCTCCCTCCATTGCCTAGGCTGG - Intronic
1053430768 9:38040442-38040464 TGTCCCTCCACTGCACTGCATGG - Intronic
1053492574 9:38520799-38520821 TTTCCCTCCATTGCCCAGGCTGG + Intergenic
1054701752 9:68419784-68419806 TGTGCCTCTTTTGCAGTGGATGG + Intronic
1055142338 9:72889792-72889814 TGCCCCTCGATTTCAAAGGAAGG - Intergenic
1055146064 9:72936440-72936462 TCTCTCTCCATTCAAGAGGAAGG - Intronic
1055610125 9:78013961-78013983 TTTCCCTCCCATGCAGGGGAGGG + Intronic
1055610126 9:78013964-78013986 TGTCCCTCCCCTGCATGGGAGGG - Intronic
1057359638 9:94361221-94361243 TGTCGCTCCATTGCCCAGGCTGG - Intergenic
1057630536 9:96715937-96715959 GCTCCCCACATTGCAGAGGATGG + Intergenic
1058629822 9:106975057-106975079 TTTCCTTCCAATGCAGAGGAAGG - Intronic
1060254015 9:122010583-122010605 TGTCCCTCCATTGCAGAGGATGG - Intronic
1061186077 9:129054426-129054448 TCTCACTCTATTGCAGAGGCTGG - Intronic
1187482892 X:19674124-19674146 TGTCCCTACATTGGAGAGAAAGG - Intronic
1192279344 X:69667837-69667859 TGTCACTCCATGGCAGAAGGTGG + Intronic
1192798327 X:74442925-74442947 TCTCCCTCTATTGCCCAGGATGG - Intronic
1195333085 X:103822043-103822065 GGTCCCTCCATTGCTCAGGCTGG - Intergenic
1196323944 X:114379108-114379130 TGTCCATCTATTTCAGAAGAGGG + Intergenic
1197071582 X:122305202-122305224 TATCTATCCATTTCAGAGGAAGG + Intergenic
1197367156 X:125578402-125578424 TGTCCTTCCATGGCAGAAGGTGG + Intergenic
1198191829 X:134315065-134315087 TGTCACTCCATTGCCTAGGCTGG - Intergenic
1199522169 X:148748618-148748640 TATCCATCCTTTGCAGAGGATGG + Intronic
1200958392 Y:8973271-8973293 GGTGCCTGCCTTGCAGAGGATGG + Intergenic