ID: 1060254594

View in Genome Browser
Species Human (GRCh38)
Location 9:122015961-122015983
Sequence TTGTGGAACTTACAGTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060254590_1060254594 -7 Left 1060254590 9:122015945-122015967 CCATCTGGTCACTGCCTTGTGGA 0: 1
1: 0
2: 0
3: 67
4: 394
Right 1060254594 9:122015961-122015983 TTGTGGAACTTACAGTAGGAGGG No data
1060254588_1060254594 -6 Left 1060254588 9:122015944-122015966 CCCATCTGGTCACTGCCTTGTGG 0: 1
1: 0
2: 0
3: 30
4: 394
Right 1060254594 9:122015961-122015983 TTGTGGAACTTACAGTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060254594 Original CRISPR TTGTGGAACTTACAGTAGGA GGG Intronic
No off target data available for this crispr