ID: 1060258294

View in Genome Browser
Species Human (GRCh38)
Location 9:122052131-122052153
Sequence TCTTTTGATGTGCTCACATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 225}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060258294_1060258296 -5 Left 1060258294 9:122052131-122052153 CCAAATGTGAGCACATCAAAAGA 0: 1
1: 0
2: 2
3: 18
4: 225
Right 1060258296 9:122052149-122052171 AAAGAAGGCATGTCCCTTTCAGG No data
1060258294_1060258298 7 Left 1060258294 9:122052131-122052153 CCAAATGTGAGCACATCAAAAGA 0: 1
1: 0
2: 2
3: 18
4: 225
Right 1060258298 9:122052161-122052183 TCCCTTTCAGGCCTGAAAGAGGG No data
1060258294_1060258301 10 Left 1060258294 9:122052131-122052153 CCAAATGTGAGCACATCAAAAGA 0: 1
1: 0
2: 2
3: 18
4: 225
Right 1060258301 9:122052164-122052186 CTTTCAGGCCTGAAAGAGGGAGG No data
1060258294_1060258297 6 Left 1060258294 9:122052131-122052153 CCAAATGTGAGCACATCAAAAGA 0: 1
1: 0
2: 2
3: 18
4: 225
Right 1060258297 9:122052160-122052182 GTCCCTTTCAGGCCTGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060258294 Original CRISPR TCTTTTGATGTGCTCACATT TGG (reversed) Intronic
901036726 1:6340387-6340409 TCTTCTGATTTTCTCACAATAGG + Intronic
901716670 1:11160848-11160870 TCTTCTGTTTTGCTCACACTGGG - Intronic
902106433 1:14040208-14040230 TATTTTAGGGTGCTCACATTTGG - Intergenic
902685719 1:18076310-18076332 TCTTTTGAAGTGCACACCTGAGG + Intergenic
903714341 1:25352873-25352895 TCTTTGAAGGTGCTCGCATTTGG + Exonic
905138377 1:35819468-35819490 TCTTTGGATGTGAGCACTTTGGG + Intronic
905730250 1:40293939-40293961 TCTTTTGCTCCGCTGACATTTGG + Exonic
908981862 1:69968030-69968052 TTTTTTGATTTCCTTACATTGGG - Intronic
909520747 1:76565137-76565159 CCTTTTGCTGGGCTCCCATTGGG + Intronic
909945353 1:81657177-81657199 CCTTTTAATATGATCACATTAGG - Intronic
911569588 1:99507373-99507395 CTTTTTGATGTGATCTCATTCGG - Intergenic
914217621 1:145647364-145647386 TCTGTTGATGCAATCACATTTGG - Intronic
914470187 1:147970056-147970078 TCTGTTGATGCAATCACATTTGG - Intronic
916806102 1:168262808-168262830 TCTTTTAATGTTTTCACATTTGG + Intergenic
917049905 1:170910071-170910093 TTTTTTGCTGTGTCCACATTTGG - Intergenic
917571860 1:176274890-176274912 TCTTTTGTTGTTCATACATTTGG + Intergenic
918108441 1:181433623-181433645 TGTTTTGATGTGCTTATCTTTGG + Intronic
919355250 1:196514357-196514379 TCTTTTTATGTACTAATATTGGG + Intronic
921944369 1:220876930-220876952 TTTTTTGATGGGCTCAAACTCGG - Intergenic
1063821074 10:9836686-9836708 TGTTGTGATGAGCTCATATTGGG + Intergenic
1064177536 10:13087878-13087900 ACTTTGGATGTGCTCACATTAGG + Intronic
1065911777 10:30312891-30312913 TCTATTGATGTCATCATATTTGG + Exonic
1066551597 10:36564357-36564379 ACTTTTGATGTGTTCATTTTTGG - Intergenic
1066586120 10:36938211-36938233 TCATTTGTTCTGCACACATTTGG + Intergenic
1066690165 10:38018473-38018495 GCTTATGATGGGCTCACCTTTGG - Intronic
1068388859 10:56365934-56365956 TATTTTGATGATCTCATATTAGG - Intergenic
1070439510 10:76429666-76429688 TCTTACGATGTGCTCCCATTTGG - Intronic
1073494681 10:103880253-103880275 TCTTTTTATGGGCTCAGAATGGG + Intergenic
1074237902 10:111604543-111604565 TCCTTTGATGTGTTTAAATTGGG + Intergenic
1076502395 10:130947711-130947733 CCTCATGATGTCCTCACATTTGG - Intergenic
1076583057 10:131527118-131527140 TCCTTTGAATTGATCACATTTGG - Intergenic
1076826016 10:132969169-132969191 TATTTTGAAGTGCTCTCATTAGG + Intergenic
1078365703 11:10704744-10704766 TCTGTTGTTGTGCTTACATGAGG + Intergenic
1082874437 11:57973604-57973626 TGTTAGGATGTACTCACATTGGG + Intergenic
1087145354 11:94805388-94805410 TCTTTTGGTTTGCTTTCATTTGG + Intronic
1087972853 11:104507043-104507065 TATTTTTAAGTGCTAACATTGGG - Intergenic
1089356406 11:117856912-117856934 TGTTTTGATGTGCTGGGATTGGG + Intronic
1092303772 12:7278978-7279000 TATTTTGATTTCCTTACATTGGG + Intergenic
1092721460 12:11445249-11445271 TCTCTTGATGTGCTAACCTTGGG - Intronic
1092932688 12:13331686-13331708 TCTTCTGATGTGCTCCAATTAGG - Intergenic
1093310825 12:17581528-17581550 TCTTTTGATTTGCTGAAATGTGG + Intergenic
1093766561 12:22970170-22970192 TCTTTTGGATTGCTCACATGGGG + Intergenic
1097200231 12:57272259-57272281 TCTTTTGATGTGCTGTGATGAGG + Intronic
1097235779 12:57538537-57538559 TCTTTTGATTTTCTCACCTCTGG - Intronic
1099559771 12:84156924-84156946 TCATTTGATGTTCTGAAATTTGG + Intergenic
1099657461 12:85511474-85511496 TCTTTTGAAGGGCACACTTTAGG - Intergenic
1099723571 12:86396316-86396338 TTTTTTAAGGTTCTCACATTGGG - Intronic
1100114494 12:91287639-91287661 TCTTTTGAAGAGCTGACTTTTGG - Intergenic
1100168825 12:91949260-91949282 TCTTCTGATTTTCTCTCATTTGG - Intergenic
1102071696 12:110025672-110025694 GCTTTTGCTGTGCTTACTTTTGG + Intronic
1103031215 12:117614905-117614927 TTTTTTGATGTGCTAAGACTTGG + Intronic
1109001944 13:56815922-56815944 TCTTTTGTTCTGCTCACTGTGGG - Intergenic
1109410508 13:61959843-61959865 TCTTTTTCTGTCCTAACATTTGG + Intergenic
1109498165 13:63202559-63202581 TCTTTTTATGTTGTCAGATTTGG - Intergenic
1113020222 13:105876826-105876848 TCTTTTGAATTTCTCACATTGGG + Intergenic
1113365644 13:109673191-109673213 TCTTTTGATGACCTCAGATAGGG + Intergenic
1117406197 14:55406606-55406628 TTTTTTAATGAGCTCTCATTGGG - Intronic
1117874078 14:60233369-60233391 TCTTCTGCTGTTTTCACATTGGG + Intergenic
1117891614 14:60427556-60427578 TCTTCTGCTTTGCTCACACTGGG + Intronic
1118868375 14:69720905-69720927 TCTTAAGATCTGCTCAAATTAGG + Intergenic
1120150708 14:81030387-81030409 TATTTTGATGTGATAACCTTAGG - Intronic
1120455761 14:84728689-84728711 CCTTTTAATATCCTCACATTGGG - Intergenic
1202936739 14_KI270725v1_random:94537-94559 TTTTTTTATATGTTCACATTTGG + Intergenic
1124557253 15:30737187-30737209 TTTTTGGATTTCCTCACATTAGG - Intronic
1124674013 15:31668562-31668584 TTTTTGGATTTCCTCACATTGGG + Intronic
1125158384 15:36615360-36615382 TCCTTTGATGTGGTCTCTTTGGG + Intronic
1128751462 15:70153093-70153115 GATGTTGATGTGCTCACATCGGG - Intergenic
1129098568 15:73236265-73236287 TCTTGTCATGTGCAAACATTGGG - Intronic
1129136937 15:73562291-73562313 TTTTTTTGTGTGCTCACATGAGG - Intronic
1131104198 15:89719739-89719761 TCCTTTGTTCTGCTCACTTTGGG + Intronic
1131859430 15:96636762-96636784 TCTTTTTATGTTCTCCCATAAGG - Intergenic
1134231533 16:12433988-12434010 TGTTTTGAGGTCCTCACATGGGG + Intronic
1135946710 16:26871507-26871529 TCTTTAGCTGAACTCACATTAGG + Intergenic
1138830829 16:60372862-60372884 TCTTCTGCTCTGCTCATATTTGG + Intergenic
1138856035 16:60693609-60693631 TCCTGTGATGTGCTAATATTTGG + Intergenic
1140549549 16:75850156-75850178 TCATTTGGTGTGTACACATTTGG + Intergenic
1147183156 17:38699557-38699579 GCTTTGGATGTGCTGACGTTGGG - Intergenic
1150637685 17:66927044-66927066 TAATTTGATGTCCTAACATTGGG + Intergenic
1151019465 17:70597987-70598009 TCTTTTGATGGTTTCACATTGGG - Intergenic
1152865572 17:82720798-82720820 TATTTTAATCTGCTGACATTTGG + Intronic
1153097522 18:1424857-1424879 TCTTGAGTTGTGCTAACATTTGG + Intergenic
1153526142 18:5996687-5996709 TGTCTTGATGTGCTCACTCTTGG - Intronic
1154276470 18:12965579-12965601 TCTTTTGAAATTCTTACATTCGG - Intronic
1156086188 18:33406497-33406519 TCTTTTCATCTCCTCAAATTTGG - Intronic
1157905048 18:51562332-51562354 TGTTTTGAAGTGCTAACCTTTGG + Intergenic
1158214364 18:55084036-55084058 TGGTTTCATGTGCTCCCATTTGG - Intergenic
1158775575 18:60574647-60574669 TCTTTGTATTTGCTCACATAAGG - Intergenic
1159382605 18:67681276-67681298 TCTTTTGATGTGCTGTTATTGGG - Intergenic
1160113408 18:76055178-76055200 TATCTTCATGTGCTCACACTTGG - Intergenic
1160113411 18:76055218-76055240 TATCTTCATGTGCTCACACTTGG - Intergenic
1160469314 18:79114271-79114293 TTTTTTGATTTGCTCCCTTTTGG + Intronic
1164719170 19:30419744-30419766 TCTCCTGATGTGCTCACATCTGG + Intronic
926939932 2:18124754-18124776 TCTTCTGAGTTGCTCACACTTGG - Intronic
927765989 2:25808782-25808804 TCCTTTGATGTGGTCTCTTTGGG - Intronic
928034272 2:27807147-27807169 CCTTTTAAAGTGGTCACATTGGG - Intronic
928734983 2:34278026-34278048 ACATTTCATGTGCTGACATTTGG - Intergenic
929090899 2:38216435-38216457 TCTTTTCATGTGTTCATAATGGG + Intergenic
929358895 2:41059439-41059461 TGTTTTGTTGTGCTAACTTTGGG - Intergenic
929401767 2:41590657-41590679 TCTTTTCTTCTGCTAACATTGGG - Intergenic
929958592 2:46479524-46479546 TCATTTGAGGTGCTGACATTTGG - Intronic
930049253 2:47201612-47201634 TCTGCTGATCTGCTCACATGAGG + Intergenic
930484262 2:51992825-51992847 TCTCTAGATGTGCTCAACTTTGG + Intergenic
933150234 2:78905720-78905742 TCTTTTCTTTTTCTCACATTGGG - Intergenic
933574198 2:84048672-84048694 TCTTTTCTTTTGCTTACATTGGG - Intergenic
935766969 2:106378118-106378140 TCTGTTAATTTGCTCAGATTGGG + Intergenic
935911745 2:107904116-107904138 TCTGTTAATTTGCTCAGATTGGG + Intergenic
936097780 2:109546208-109546230 TCTCTTAAGGTGCTCAAATTTGG + Exonic
936366037 2:111856712-111856734 TCTGTTAATTTGCTCAGATTGGG - Intronic
936832491 2:116664890-116664912 TGTATAGATGTGTTCACATTGGG + Intergenic
937796824 2:126033137-126033159 TCTTTTGATATGCTCATTTATGG + Intergenic
938689190 2:133771305-133771327 TCTTTTGAATTACTCACTTTGGG + Intergenic
939561846 2:143741764-143741786 CCTTTTGATGTCCTGAAATTTGG - Intronic
939744528 2:145952273-145952295 TCTTCTGCTTTGCTCACACTGGG + Intergenic
940532765 2:154901359-154901381 TCATTTGATGTGGTAGCATTTGG + Intergenic
940877435 2:158912181-158912203 TTTTTTGCTATGCTCATATTTGG + Intergenic
941622324 2:167792289-167792311 TCTAGTGATCTGCTCACAGTAGG - Intergenic
948007990 2:234626365-234626387 TCTTTTTTTCTGCTCACTTTGGG + Intergenic
948298535 2:236884431-236884453 TCTTTTGCGGAGTTCACATTGGG - Intergenic
1168945324 20:1750258-1750280 TCTTTTCATGTGCTTATCTTTGG - Intergenic
1169757369 20:9057598-9057620 TCTCTTGGTTTGCTGACATTTGG - Intergenic
1170091305 20:12592398-12592420 TGTTTGGATGTGTTCACATGAGG - Intergenic
1170526899 20:17247816-17247838 TCTTTTTATCTGTTCACAATTGG + Intronic
1171027899 20:21648733-21648755 TTTTTGGATGTCCTTACATTGGG - Intergenic
1171374198 20:24681047-24681069 CCTTCTGATGTGCACACATTAGG + Intergenic
1171844392 20:30256302-30256324 TCAGTTGGTGTGCTAACATTGGG + Intergenic
1171847615 20:30286599-30286621 TCTTGTGATGTGTTTACATTGGG - Intergenic
1172225796 20:33304432-33304454 TCTTTTGATCAGCCCACATAGGG + Intronic
1175374931 20:58517616-58517638 TCTTTTGGGGTCCTCAGATTTGG - Intergenic
1176586574 21:8594439-8594461 TTTTTTTATATGTTCACATTTGG - Intergenic
1177950956 21:27536420-27536442 TTTTTTGAAGTTCTTACATTTGG - Intergenic
1179062196 21:37989414-37989436 TCTTTCCATGTGCACACATTGGG + Intronic
1180269382 22:10571344-10571366 TTTTTTTATATGTTCACATTTGG - Intergenic
952033916 3:29177066-29177088 ATTTTTTATGTACTCACATTAGG - Intergenic
952615931 3:35274079-35274101 TCTTTTAATGCTATCACATTGGG - Intergenic
953249084 3:41226930-41226952 TCTTTTGGTGTGATCACTGTGGG + Intronic
955748624 3:62165437-62165459 TCATTTGAGTGGCTCACATTTGG + Intronic
957827258 3:85464278-85464300 TAGATTGATGTGATCACATTTGG - Intronic
957877565 3:86168989-86169011 TCTTATGATCTGATGACATTTGG - Intergenic
958909064 3:99972945-99972967 TCTTTTGATCTTCACACCTTTGG + Intronic
960584874 3:119311410-119311432 TCTTATGAAGTGATTACATTAGG + Intronic
961352585 3:126313456-126313478 TCTTTAAATGAGGTCACATTTGG + Intergenic
962551461 3:136496756-136496778 TCCTTTCATCTGCTCACTTTGGG - Intronic
963448639 3:145447988-145448010 TCTTATGATGTGCTGAAATGAGG - Intergenic
965931850 3:174053548-174053570 TGTTTTGATGTGCTGGTATTTGG + Intronic
971621387 4:28857605-28857627 TCTTTTGTGTTGCTCACACTGGG + Intergenic
972925844 4:44005857-44005879 TCTTTTCCTGTTCTTACATTGGG + Intergenic
973627322 4:52785784-52785806 GCTTTTGATGTGACCACCTTGGG - Intergenic
973897616 4:55430823-55430845 TCTTTTGGTGTCCACACAATAGG + Exonic
978631231 4:110747799-110747821 TCTTATGAGGTACTCCCATTTGG - Intergenic
979852879 4:125594858-125594880 TCATTTGAAATGCTCACTTTTGG - Intergenic
980688671 4:136262579-136262601 TCTTTAGAAGTGCTAAAATTAGG - Intergenic
983792458 4:171814000-171814022 TCTTTTCCTGTGCTCCCCTTGGG - Intronic
984016572 4:174434036-174434058 TGTTTTGTAGTGCTCTCATTTGG + Intergenic
984063134 4:175016991-175017013 TTTTTTGATGAGCCCATATTGGG + Intergenic
984332012 4:178334804-178334826 TTTTTTAATGAGCTCATATTAGG - Intergenic
987754094 5:22077814-22077836 TCTGTTGATGTGTACATATTTGG + Intronic
988154593 5:27433853-27433875 GCTTTTTATGTGCTCACTTGAGG + Intergenic
990046003 5:51432458-51432480 TCTTTAAATCTGTTCACATTTGG - Intergenic
991284127 5:64951336-64951358 TCTTTTCATGTGCTTAAATCAGG + Intronic
992785321 5:80164699-80164721 TCTTTTGTTCTGCTAACTTTGGG + Intronic
993113833 5:83694404-83694426 TTTTTTGTTCTGCTTACATTGGG - Intronic
993937950 5:94026320-94026342 TCCTTTGGTGTACCCACATTCGG + Intronic
994079952 5:95697410-95697432 TCTTTTGAACTGCTCACCATGGG - Intronic
995584623 5:113635540-113635562 TCTGTTGATGTGATCCAATTTGG - Intergenic
997414737 5:133717284-133717306 TCTTTTGAAGTTCTAAAATTAGG - Intergenic
998269465 5:140693614-140693636 TCTCTTGATGTGCTTTCAGTTGG - Exonic
998974632 5:147630945-147630967 TCTTTTGATGTGTTTAATTTAGG - Intronic
999579151 5:153014692-153014714 TGCTTTGATGTCTTCACATTAGG - Intergenic
1000100051 5:158007590-158007612 TCTTTTTATGTGCACAGAATAGG - Intergenic
1000594896 5:163203493-163203515 TCTTTTGTTTTGCTTACTTTGGG + Intergenic
1001676674 5:173523883-173523905 TTTTTTGATGTTCTGCCATTGGG + Intergenic
1003515068 6:6811070-6811092 TCTTTTCATTTGCTCCCTTTGGG - Intergenic
1005308953 6:24540968-24540990 ACTATTGATGTGATCAAATTAGG - Intergenic
1005309504 6:24545874-24545896 TGTTTAGGTGTGCTCACACTTGG + Exonic
1005660727 6:27996626-27996648 TCTTTTGCTGTGTTCATTTTAGG - Intergenic
1006995353 6:38254639-38254661 TCTTTTCATGTGCTTACTTGGGG - Intronic
1008871156 6:56273432-56273454 TCTTTTGAAGTACTAACTTTTGG - Intronic
1010741827 6:79515378-79515400 TGTTTTCATCTTCTCACATTAGG - Intronic
1011081569 6:83495709-83495731 TCTTCTGAGTCGCTCACATTGGG - Intergenic
1012481968 6:99676880-99676902 TCTTCTGTGTTGCTCACATTGGG + Intergenic
1012800161 6:103816209-103816231 TGTTTTGATATGCAGACATTGGG - Intergenic
1013255711 6:108382895-108382917 TCTTTTGTTGTTCTCATATTAGG - Intronic
1013956156 6:115843430-115843452 TATTCTGCTGTGCTCAGATTTGG - Intergenic
1015782302 6:136881469-136881491 TCTTTTGGTGATCTCATATTTGG + Intronic
1017261162 6:152389428-152389450 TATTTTGTTATGATCACATTGGG + Intronic
1017537068 6:155359052-155359074 TCTTTCCATTTGCTAACATTGGG - Intergenic
1018371336 6:163170913-163170935 TCATTTGATGAGCTGACATTAGG - Intronic
1020653419 7:10902362-10902384 TATTTTCATTTGCACACATTTGG + Intergenic
1020877427 7:13715571-13715593 TCTCTTGAAATGCTCACACTTGG + Intergenic
1022081514 7:27026376-27026398 TCCTTTGATGTGGTCTCTTTGGG + Intergenic
1024775653 7:52782567-52782589 GCTTTTGAGGAGCTTACATTTGG + Intergenic
1026745418 7:73007605-73007627 TCTTTGGATGAGCAGACATTGGG + Intergenic
1027348534 7:77287202-77287224 TCTTCTGATGTGCTCCCATCAGG - Intronic
1029027849 7:97436727-97436749 TCTTTTGATGTTTGCAGATTCGG + Intergenic
1030000727 7:105057930-105057952 TTTTGTGATGTGTTCAAATTGGG + Intronic
1030454604 7:109757827-109757849 TCTTGTGTTGTGCTAACTTTGGG + Intergenic
1031053661 7:116970989-116971011 TCCTTTGATGTGGTCTCTTTGGG - Intronic
1031602734 7:123731876-123731898 TCTTTTCATCTGCTAACTTTGGG - Intronic
1031943171 7:127811078-127811100 TCTTTTGATGAGCAAATATTGGG + Intronic
1032468263 7:132160475-132160497 TCTCTTGCTGTTCTCACAGTGGG + Intronic
1032493075 7:132339448-132339470 TCTTTTCATGTGATAAAATTTGG - Intronic
1034555901 7:151850184-151850206 TCATTTGATGTGCCCACTATGGG - Intronic
1035438399 7:158876555-158876577 TTTTTTGATGTGCTAACATTTGG + Intronic
1036018101 8:4808731-4808753 TGTTTTAATGTTCTCCCATTAGG - Intronic
1036505165 8:9348255-9348277 TCTATTCATGTGCTACCATTGGG + Intergenic
1038084685 8:24181878-24181900 TATTTTGATGTTCTGTCATTAGG - Intergenic
1039384920 8:37126954-37126976 ACTTTTGATATAATCACATTTGG + Intergenic
1041128958 8:54676098-54676120 TCTCTTAATGTTATCACATTGGG + Intergenic
1041307435 8:56477001-56477023 TCTCTTAAGGTGCTCAAATTTGG + Intergenic
1041896812 8:62934426-62934448 TGTGTTGATTTTCTCACATTTGG - Intronic
1044031889 8:87248730-87248752 TCTTTTGATGTCCCCTCATTGGG + Intronic
1045337037 8:101215176-101215198 TCTTATGATGTTTTGACATTTGG + Intergenic
1045890372 8:107149075-107149097 TCTTTTGAAGTGATCACTTTGGG - Intergenic
1046634298 8:116655902-116655924 TCTTTTCAAGTTCCCACATTAGG + Exonic
1048759328 8:137774703-137774725 TCTTTTGATTTTCTCATAATGGG - Intergenic
1049666898 8:143848921-143848943 TCTTTTGAGTTTCTCACCTTTGG + Intergenic
1051470804 9:17439704-17439726 ACTTTTGAAATGATCACATTGGG - Intronic
1051471688 9:17450130-17450152 TGTCTTGATGTGTTCAAATTAGG - Intronic
1051539012 9:18193575-18193597 TCCTTTCATGTCCTCACATCTGG - Intergenic
1052090918 9:24326401-24326423 GCATTTTATGTGCTCTCATTTGG + Intergenic
1052400845 9:27998265-27998287 TCTTTTGGAATGCTCACTTTCGG + Intronic
1054159316 9:61662942-61662964 TCTTGTGATGTGTTTACGTTGGG + Intergenic
1054479090 9:65593947-65593969 TCTTGTGATGTGTTTACGTTGGG + Intergenic
1054745934 9:68853790-68853812 TCTTGTGAGGTGCTCTCATGGGG - Intronic
1054747619 9:68870703-68870725 TGTCTTGATGTGCAGACATTAGG - Intronic
1056547593 9:87625728-87625750 TATTTTATTGTTCTCACATTTGG + Intronic
1057054864 9:91952473-91952495 TCTTTTGGATTGCTCACTTTGGG - Intergenic
1057621859 9:96643478-96643500 CCTTGTGATCTGCTCACCTTGGG + Intronic
1060258294 9:122052131-122052153 TCTTTTGATGTGCTCACATTTGG - Intronic
1186088215 X:6014378-6014400 TCTTTGAATGTGAACACATTTGG + Intronic
1186674427 X:11801347-11801369 TCTTTTGAAGGGCTCCTATTTGG + Intergenic
1188210034 X:27411712-27411734 TCTTTTTATGAGCTCAAATAAGG - Intergenic
1188642337 X:32521835-32521857 TCTTTTAATATCATCACATTGGG - Intronic
1188926272 X:36048524-36048546 TCTTTAGATTTTGTCACATTTGG + Intronic
1191615518 X:63166097-63166119 TCTTTTGGTGGCCTCACATGTGG - Intergenic
1191620780 X:63212826-63212848 TCTTTTGGTGGCCTCACATGTGG + Intergenic
1191758969 X:64626716-64626738 TCTTTGGATCTAATCACATTAGG - Intergenic
1193632216 X:83904003-83904025 TAATTTGATGTGATCCCATTAGG - Intergenic
1193920180 X:87415303-87415325 TATCATGATGTGCCCACATTAGG + Intergenic
1194381836 X:93202173-93202195 TCTGTTGAGATGCTCACAATCGG + Intergenic
1195290057 X:103423804-103423826 TCTTGAGATGTGCTGACATCAGG - Intergenic
1199219406 X:145299736-145299758 TTTTTTCATGTGCTTGCATTTGG - Intergenic
1199413726 X:147555712-147555734 CCTTTGAATGTGCTCAGATTTGG + Intergenic
1202081940 Y:21092696-21092718 TCTCTTGGTGGGGTCACATTAGG - Intergenic
1202333360 Y:23778556-23778578 TCTTCTGATTCGCTCACACTTGG + Intergenic
1202537409 Y:25891507-25891529 TCTTCTGATTCGCTCACACTTGG - Intergenic