ID: 1060258301

View in Genome Browser
Species Human (GRCh38)
Location 9:122052164-122052186
Sequence CTTTCAGGCCTGAAAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060258294_1060258301 10 Left 1060258294 9:122052131-122052153 CCAAATGTGAGCACATCAAAAGA 0: 1
1: 0
2: 2
3: 18
4: 225
Right 1060258301 9:122052164-122052186 CTTTCAGGCCTGAAAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060258301 Original CRISPR CTTTCAGGCCTGAAAGAGGG AGG Intronic
No off target data available for this crispr