ID: 1060259290

View in Genome Browser
Species Human (GRCh38)
Location 9:122059938-122059960
Sequence CACTATGACAAGCAGCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 146}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060259290_1060259299 4 Left 1060259290 9:122059938-122059960 CCCCACAGCTGCTTGTCATAGTG 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1060259299 9:122059965-122059987 CCATAGGTAATTGATAACATGGG No data
1060259290_1060259300 26 Left 1060259290 9:122059938-122059960 CCCCACAGCTGCTTGTCATAGTG 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1060259300 9:122059987-122060009 GTATCTGCTTTCTTCCTGACTGG No data
1060259290_1060259301 30 Left 1060259290 9:122059938-122059960 CCCCACAGCTGCTTGTCATAGTG 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1060259301 9:122059991-122060013 CTGCTTTCTTCCTGACTGGCTGG No data
1060259290_1060259297 3 Left 1060259290 9:122059938-122059960 CCCCACAGCTGCTTGTCATAGTG 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1060259297 9:122059964-122059986 CCCATAGGTAATTGATAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060259290 Original CRISPR CACTATGACAAGCAGCTGTG GGG (reversed) Intronic
902312519 1:15592404-15592426 AACTGTGAAAAGCAGCTCTGGGG + Intergenic
903281571 1:22253004-22253026 GTCTGTGGCAAGCAGCTGTGGGG + Intergenic
907643214 1:56213680-56213702 CTCTATGAGATGCAGCAGTGTGG - Intergenic
908368591 1:63455756-63455778 GATTATCACAAACAGCTGTGGGG - Intronic
909158829 1:72118123-72118145 CACTATAACACTGAGCTGTGTGG + Intronic
909508276 1:76420062-76420084 CACTAAGAAAAGGAGCTATGGGG - Intronic
911615491 1:100006311-100006333 CACTAAAACAAGCTGCTGGGAGG - Intronic
917487748 1:175470055-175470077 CACTGTGAAAAGAAACTGTGAGG + Intronic
917985368 1:180311658-180311680 CCCTCTGACTAGCAGCTGGGAGG + Intronic
920691993 1:208154189-208154211 CACTCTGCCCAGCAGCTGTGGGG - Intronic
920834159 1:209492491-209492513 CACTATGCTAAGCACCAGTGAGG + Intergenic
921363476 1:214352031-214352053 GAATATGACAAGCATTTGTGTGG - Exonic
1063197310 10:3755679-3755701 CTCTGGAACAAGCAGCTGTGTGG + Intergenic
1063901230 10:10734467-10734489 CACTGTGACAAGAGGATGTGGGG - Intergenic
1064428543 10:15251862-15251884 CACAAAGACAAGCAGGTGTCAGG + Intronic
1067807016 10:49399443-49399465 CACTAAGACATGCGGCTCTGGGG - Intergenic
1069075741 10:64036897-64036919 CACCATTAAAAACAGCTGTGTGG + Intergenic
1069177208 10:65307017-65307039 CACTATAGAAAGCAGCAGTGTGG - Intergenic
1069197869 10:65574938-65574960 CACTATCACAAGCAGCTGTCAGG + Intergenic
1070117100 10:73539579-73539601 CACTCTGAAAAACAGCTGAGGGG + Exonic
1070278297 10:75029264-75029286 CACTGTTACAAGAAGCTGTCAGG - Exonic
1073112869 10:101073225-101073247 CACCCTGACAAGCAGCCTTGGGG + Intergenic
1073329094 10:102659342-102659364 CTCTGTGACAAGCAGCAGGGAGG - Intergenic
1074305472 10:112274148-112274170 GACTATGACCCTCAGCTGTGTGG - Intergenic
1076670049 10:132115408-132115430 CAGGCTGACAAGCGGCTGTGCGG - Intronic
1081035785 11:38144252-38144274 CACTATGCAAAGCAGTTTTGGGG - Intergenic
1081579802 11:44344501-44344523 CACCTTGCCAAGCTGCTGTGAGG + Intergenic
1081957391 11:47105247-47105269 CACTTTGGGAAGCAGATGTGAGG + Intronic
1082932619 11:58624370-58624392 CTCTTTGAGAAGAAGCTGTGGGG + Exonic
1084064363 11:66694856-66694878 CACAATGCCTAGCAGATGTGGGG + Intronic
1084331251 11:68431944-68431966 GAGAATGACAAGCACCTGTGCGG - Intronic
1084954998 11:72686322-72686344 CGATATGAGAAGCAGCTGTGGGG + Intronic
1085769040 11:79308853-79308875 CACTTTTGCAAGCTGCTGTGAGG + Intronic
1088729155 11:112665535-112665557 CACTCTGAGATGCAGCTCTGTGG - Intergenic
1096402208 12:51316650-51316672 ATCTATGACAAGCAACAGTGTGG - Intronic
1097740411 12:63235200-63235222 AAATATAACAAGAAGCTGTGTGG - Intergenic
1101643943 12:106610885-106610907 CACTATGAAAACCAGTTTTGTGG - Intronic
1102057717 12:109909187-109909209 CACCATGAAAACCAACTGTGAGG + Intronic
1104002802 12:124871051-124871073 CACCATGCCAGGCAGCTGCGTGG + Intronic
1104965134 12:132505526-132505548 CACCATGACAGGCAGCAGCGTGG - Intronic
1106289271 13:28345498-28345520 CACTCTAACATGCACCTGTGTGG - Exonic
1107060337 13:36153714-36153736 GACTCAGACAAGCAGTTGTGGGG + Intergenic
1110679569 13:78292823-78292845 CATTATGACAAGCAGGTCTAGGG - Intergenic
1120951233 14:90044036-90044058 AGCTATGAAAAGCCGCTGTGAGG - Exonic
1124995415 15:34718921-34718943 CACTGTGACAAGCAGCATTGTGG + Intergenic
1125148124 15:36497001-36497023 TGCTATGACAAGCAGTTGTAAGG - Intergenic
1126316268 15:47373231-47373253 AACTATGACAAGCACAAGTGGGG - Intronic
1127280508 15:57486829-57486851 AACTATTGCAAGCAGCTGTTGGG - Intronic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1128613874 15:69094468-69094490 AACTATGGCAAGCTGCTGAGTGG + Intergenic
1128774675 15:70310943-70310965 TACTATGTCAATCAGCTCTGAGG - Intergenic
1129654924 15:77517725-77517747 CCCCATGACATGCAGCTCTGAGG - Intergenic
1135886103 16:26309659-26309681 CTCATTGAGAAGCAGCTGTGTGG - Intergenic
1138990700 16:62387502-62387524 CTCTGTGACTAGCAGCTGTGAGG - Intergenic
1139673505 16:68507654-68507676 AACTCTGAGAAGCAGCTCTGAGG + Intergenic
1139802077 16:69530885-69530907 AACTATGAGAAGCAGCTCCGTGG - Intergenic
1141623573 16:85249768-85249790 CACTTGGGCACGCAGCTGTGAGG - Intergenic
1143609530 17:8009727-8009749 CACTTTGAGAGGCAGATGTGAGG + Intronic
1144268335 17:13593349-13593371 CTCTATGACAGGAAGCTTTGGGG + Intronic
1144593809 17:16548324-16548346 CACTATGAAATACATCTGTGAGG + Intergenic
1147476200 17:40713921-40713943 CACTATGATGAACAGCTGAGAGG + Intergenic
1147597345 17:41725463-41725485 TCCTATGGCAAGTAGCTGTGGGG - Intronic
1154086581 18:11311333-11311355 CACTATGACAAGGTGCTGAAGGG + Intergenic
1155891208 18:31271508-31271530 AACTGTGAAAAGCAGTTGTGGGG + Intergenic
1162249546 19:9430715-9430737 CATTATGGTCAGCAGCTGTGGGG - Intronic
1164453409 19:28386185-28386207 CACTTTCTCAGGCAGCTGTGAGG - Intergenic
1165275688 19:34749204-34749226 CTCCATGGCAAGCAGCTTTGGGG + Intergenic
1165930658 19:39356423-39356445 CACTATGACAGCCAGGTGTGAGG + Intronic
1167765246 19:51478477-51478499 CACTCTGACCAGCAGGGGTGGGG - Intergenic
925531484 2:4867920-4867942 CACCATGACCTGCTGCTGTGTGG - Intergenic
927229222 2:20803422-20803444 CAGTATACCAAGCTGCTGTGTGG - Intronic
928530500 2:32186319-32186341 CACTATGATAATCAGTTGTAAGG + Intronic
932859105 2:75270041-75270063 CACTATGAAAAGCAGCATGGAGG - Intergenic
934945610 2:98539097-98539119 CACAATGATAAGCAGCAGAGAGG - Intronic
936244435 2:110814274-110814296 CACAGTGACACACAGCTGTGAGG - Intronic
938917139 2:135953427-135953449 CACTCAAAAAAGCAGCTGTGTGG - Intronic
940983027 2:160024282-160024304 CCCCATGCCAAGCTGCTGTGGGG + Intronic
946017680 2:216617193-216617215 CACTGTGACAAGTTGCTGAGAGG + Intergenic
946279419 2:218656103-218656125 CAGTGGGACAAGCAGCTCTGAGG - Intronic
946593584 2:221279588-221279610 CACTATAACAAGATGCTGTCTGG + Intergenic
949045819 2:241872245-241872267 CCCTGTGACTGGCAGCTGTGAGG + Exonic
1168892726 20:1305443-1305465 ACCTATGAGAAGCTGCTGTGTGG + Exonic
1173505630 20:43584932-43584954 CACTGTGGCCAGCAGCTCTGGGG + Exonic
1175226246 20:57445532-57445554 CATGATGAAAACCAGCTGTGAGG - Intergenic
1175366742 20:58461155-58461177 CTCTGAGCCAAGCAGCTGTGGGG - Exonic
1175657568 20:60784894-60784916 CACTGTCAGGAGCAGCTGTGGGG + Intergenic
1181302298 22:21889404-21889426 CCCCATGACAGGCAGCTGTGGGG + Intergenic
1181498917 22:23304717-23304739 CACTATAACCAGCATCGGTGAGG - Intronic
1182136272 22:27906616-27906638 CACTATAAAAAGTTGCTGTGAGG + Intronic
1184233303 22:43169839-43169861 GACTTTGCCACGCAGCTGTGAGG + Intronic
949643688 3:6068525-6068547 GACTAAGAAAAGGAGCTGTGTGG + Intergenic
952610118 3:35198676-35198698 CTCTATGACAAGAAGCTGGGTGG + Intergenic
953858566 3:46521958-46521980 CATGACGACATGCAGCTGTGAGG - Intronic
956850755 3:73226119-73226141 CACTATGACAACCATTTATGTGG - Intergenic
957357384 3:79110131-79110153 TACTTTGCCAAGCTGCTGTGAGG + Intronic
959639973 3:108621679-108621701 CACTATGGCAAGCAGTTTGGAGG + Intronic
968148878 3:196321516-196321538 CCGTGTGAGAAGCAGCTGTGAGG + Intronic
968509680 4:990039-990061 CACGATGACCAGCAGCTCCGTGG + Exonic
974295525 4:59994284-59994306 CACCATGAGAAGCAACAGTGTGG - Intergenic
976077377 4:81314885-81314907 CAGGATGACAAGCAGCTATCAGG + Intergenic
977564246 4:98565699-98565721 CTTTATCACAAGCAGCTGAGAGG + Intronic
985294361 4:188419229-188419251 CAGTATGAAGAGGAGCTGTGGGG + Intergenic
986300501 5:6474887-6474909 CACAATGCCATGCAGCTGTCAGG - Intronic
986496207 5:8344392-8344414 CACTATGACATGGACCTGTGAGG - Intergenic
986717543 5:10534796-10534818 GACTTTGGAAAGCAGCTGTGTGG + Intergenic
986922034 5:12697061-12697083 GACTATGACAATCATCAGTGTGG + Intergenic
987276935 5:16372669-16372691 CACTCTGCCATGCTGCTGTGAGG - Intergenic
988525570 5:31984237-31984259 TACTATGAAATCCAGCTGTGAGG + Intronic
988949673 5:36243198-36243220 CACTATTAGCAGCTGCTGTGAGG - Intergenic
990887101 5:60607152-60607174 CAGTATGACATGCAGTTATGAGG + Intronic
992277860 5:75139792-75139814 CACTATGGAAGGCAGGTGTGTGG + Intronic
995307606 5:110672244-110672266 CACTATTAGCAGCAGATGTGAGG - Intronic
996217457 5:120887086-120887108 CACAATGGGAAGCAGCAGTGGGG - Intergenic
997023406 5:130028905-130028927 CAGTAGGAGAAGCAGATGTGGGG - Intronic
999131517 5:149287142-149287164 CACGATGACAAGCAGCAATATGG + Intronic
999298444 5:150475264-150475286 CCCTCTGACCAGCAGCTGAGAGG + Intergenic
1000747395 5:165051409-165051431 CACTGTGAAAAGCAGTTTTGTGG - Intergenic
1002647398 5:180666871-180666893 CACTTTAACAAGCAGCCTTGAGG - Intergenic
1003364415 6:5458501-5458523 CACTATGATTAGCAGTTATGGGG - Intronic
1003760980 6:9178426-9178448 GACTATGACAATCAGCTTTTTGG - Intergenic
1011478647 6:87772640-87772662 CACAATGAAAACCAGCAGTGTGG + Intergenic
1011921933 6:92588792-92588814 TATTATGAGAAACAGCTGTGGGG - Intergenic
1016502461 6:144736935-144736957 CAGGATGACCAGCAGCTGCGTGG - Intronic
1018509281 6:164507496-164507518 CACCATGGCCAGCAGCTGTGGGG - Intergenic
1023905920 7:44521534-44521556 CTCTGTGAGAAGCACCTGTGTGG - Intronic
1024360887 7:48466941-48466963 CACAATGAACAGCAGCAGTGGGG + Exonic
1026668173 7:72362644-72362666 CAGAATGACAGCCAGCTGTGTGG - Intronic
1028718958 7:94007197-94007219 CACCATGACAAGTTGGTGTGGGG - Intergenic
1029745964 7:102516062-102516084 CACTAGGGCCAGCTGCTGTGGGG + Intronic
1029763902 7:102615041-102615063 CACTAGGGCCAGCTGCTGTGGGG + Intronic
1034593088 7:152160495-152160517 CATTCTGAGAAGCAGGTGTGTGG + Intronic
1034694869 7:153044307-153044329 TACAATGACAAGCAGATGTAGGG - Intergenic
1035035846 7:155893240-155893262 CCCGAAGAGAAGCAGCTGTGGGG - Intergenic
1035127390 7:156618464-156618486 CACTCTGCCGGGCAGCTGTGCGG + Intergenic
1038034517 8:23675859-23675881 CAATATGCCTAGCAGCTGGGAGG - Intergenic
1038901496 8:31849314-31849336 CACTCAGATATGCAGCTGTGCGG - Intronic
1039211664 8:35223420-35223442 CACTATGATATGTAGCTGTGTGG + Intergenic
1041123643 8:54612343-54612365 CCCCATGGCAGGCAGCTGTGGGG - Intergenic
1042953266 8:74222340-74222362 CCCTATTACTACCAGCTGTGTGG + Intergenic
1043603541 8:81971324-81971346 CAATATGGCAAACAGCAGTGGGG + Intergenic
1047924756 8:129671878-129671900 CCCAAGGACAAGCAGCAGTGGGG + Intergenic
1048980141 8:139698909-139698931 CACTCTGAGAAACAGCTTTGGGG - Intronic
1049256984 8:141619418-141619440 CTGTATGAGAAGCAGCTGGGAGG - Intergenic
1049358909 8:142202522-142202544 AACCATGACAAGCAGGAGTGAGG - Intergenic
1049943959 9:576481-576503 CACTATGACAAGCATATGATTGG - Intronic
1050375895 9:4972508-4972530 TACTATGAGAAGCAGATGTCAGG - Intergenic
1051184195 9:14441645-14441667 TACTATGACAAGCAGCTTCCTGG + Intergenic
1052016157 9:23470403-23470425 CACTTTGGCAAGCAGCTGGACGG + Intergenic
1060259290 9:122059938-122059960 CACTATGACAAGCAGCTGTGGGG - Intronic
1189054483 X:37685341-37685363 CACTTTGAAAAGCCTCTGTGTGG + Intronic
1191866104 X:65705100-65705122 CACACTGCCTAGCAGCTGTGTGG + Intronic
1194200684 X:90950449-90950471 GCCTATAAGAAGCAGCTGTGGGG + Intergenic
1195003870 X:100668188-100668210 GACTAAGAGAAGCAGCTCTGGGG + Intronic
1195657767 X:107348601-107348623 CTCTATGTCAAACAGATGTGGGG + Intergenic
1195733018 X:107984553-107984575 CCCTACCACAAGAAGCTGTGAGG - Intergenic
1195870637 X:109481472-109481494 GACTATGACAAATAGCTCTGAGG + Intronic
1196932139 X:120692908-120692930 CAGCATGACAGGCAACTGTGGGG + Intergenic
1201508693 Y:14733860-14733882 CTCTATGAGATGCTGCTGTGGGG - Intronic