ID: 1060260809

View in Genome Browser
Species Human (GRCh38)
Location 9:122072081-122072103
Sequence TCATGCAGGCCTACACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060260809_1060260816 24 Left 1060260809 9:122072081-122072103 CCTTCCAGTGTAGGCCTGCATGA 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1060260816 9:122072128-122072150 ACTCAGAAAGCTGAAGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060260809 Original CRISPR TCATGCAGGCCTACACTGGA AGG (reversed) Intronic
901324237 1:8357451-8357473 TCATCCTGCCCCACACTGGAGGG + Intronic
903968867 1:27106313-27106335 TCATGGAGGCCTCCAGTGGCTGG + Intronic
906888130 1:49675169-49675191 TCATGCAGGCCATCCCTAGAAGG + Intronic
907122622 1:52020805-52020827 TCATTCCTACCTACACTGGAAGG - Exonic
909305239 1:74066812-74066834 TCATTCAAACCTAAACTGGATGG + Intronic
923872348 1:238009391-238009413 TCTTGCAGGCCTAAGATGGAAGG + Intergenic
1063389656 10:5640951-5640973 TCCTGTAGGCCTTCTCTGGAAGG + Intronic
1066442784 10:35454649-35454671 TCATGCAGGGCCCCACTGGCTGG - Intronic
1071338815 10:84623972-84623994 CCCTGCAGGCCTAAGCTGGAAGG + Intergenic
1078077591 11:8175754-8175776 TCATGCTGGCCTAGAGAGGAGGG - Intergenic
1080554368 11:33402578-33402600 TGATGCAGGCTAACACTGTAAGG - Intergenic
1084310679 11:68314420-68314442 TGATCCAGGCCTAAAATGGAAGG + Intronic
1087354748 11:97078112-97078134 TCCTGCAGGCCTGCACAGTAAGG + Intergenic
1090059035 11:123447973-123447995 TTAAGCAGGCCAACACTGAAGGG - Intergenic
1092170289 12:6370112-6370134 GCAGGCAGCCCTACATTGGAGGG + Intronic
1096386757 12:51199408-51199430 TCTTACAGGCATCCACTGGAGGG + Intronic
1097681090 12:62649692-62649714 GCAGGCAGGCCTACACAGGGAGG - Intronic
1099095475 12:78370142-78370164 TCCAGCTAGCCTACACTGGAGGG + Intergenic
1099428651 12:82553852-82553874 TCATGCTGGGTTCCACTGGAAGG + Intergenic
1101293354 12:103394820-103394842 GCATGTAGCCCCACACTGGATGG - Intronic
1101576419 12:106001219-106001241 TCAGGCATACCTACACTTGAAGG + Intergenic
1104548254 12:129732028-129732050 TAAGGCCGGCCTACACTCGATGG - Intronic
1106836727 13:33642988-33643010 TCTTGCAGGCCTTCATTGCAGGG - Intergenic
1116473900 14:45317804-45317826 TTTTGCAGGCCTGCACTTGATGG - Intergenic
1119656318 14:76419834-76419856 TCAGGCCAGCCTAAACTGGAAGG - Intronic
1120646762 14:87083737-87083759 TCCTGTTGGCCTGCACTGGATGG + Intergenic
1121661592 14:95639308-95639330 TCATGCAGGCCCTCAGTGGCTGG + Intergenic
1121889839 14:97579314-97579336 TAATGCAGGTTTACACTAGAGGG + Intergenic
1122067813 14:99185694-99185716 TGAGCCAGGCCTGCACTGGATGG - Intronic
1122740240 14:103867953-103867975 TCTTGCAGGCCAACAGTGTAGGG + Intergenic
1125171151 15:36768129-36768151 TCATGCAGGCCAACACTGTCTGG - Intronic
1126087576 15:45023885-45023907 AGATGGAGGCCTAGACTGGAAGG - Intronic
1136050773 16:27648404-27648426 TCATCCGGGCCAGCACTGGATGG - Intronic
1138245021 16:55460940-55460962 TCCTCCAGGCCTGGACTGGATGG + Intronic
1138586323 16:57972608-57972630 TCTTGAAGCCCAACACTGGAGGG - Intergenic
1142229874 16:88895159-88895181 TCCTGCAGGCCTGGACTGGAAGG + Intronic
1144556138 17:16284569-16284591 TTTTGCAGGCCTGCACTTGATGG + Intronic
1145728789 17:27157032-27157054 TCATGCAGCCCTCCAATAGAAGG + Intergenic
1147694511 17:42341139-42341161 TCAAGCAGGACTACACTTAAAGG + Intronic
1150492530 17:65584255-65584277 TCATGCAGCCCTGCACTGCTGGG + Intronic
1150604354 17:66678219-66678241 TCATGCCTGCCACCACTGGAAGG + Intronic
1151377793 17:73703244-73703266 CACTACAGGCCTACACTGGAAGG - Intergenic
1155514802 18:26613910-26613932 TCATTCAGGCCTACACTCAATGG + Intronic
1160796870 19:949618-949640 TCCAGCAGGCATCCACTGGAGGG - Intronic
1161874247 19:6895334-6895356 GAATGCAGTCCTAAACTGGATGG + Intronic
1162860563 19:13503731-13503753 TTATACAGCCCTACTCTGGAAGG - Intronic
1167775393 19:51551328-51551350 TCTTGCAAGCCTACTCTAGATGG + Intergenic
931905094 2:66833934-66833956 ACATGACTGCCTACACTGGATGG + Intergenic
937814485 2:126236438-126236460 TCATCCATGCCTACAGAGGAAGG - Intergenic
937890704 2:126936410-126936432 CCATGCAGGCCAACACTGTGAGG + Intergenic
943389219 2:187242444-187242466 ACATTTAGGCCTACACTGGCTGG - Intergenic
946516478 2:220417128-220417150 TCATCCAGACCAACCCTGGAGGG - Intergenic
1170125656 20:12960654-12960676 TCATGGACCCCTGCACTGGATGG + Intergenic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1176213085 20:63934884-63934906 GCATGCAGGCTGCCACTGGAGGG + Exonic
1178923904 21:36759640-36759662 TTATGCATGCCTACATTGGCAGG - Intronic
1184876867 22:47281831-47281853 ACATGCAGGCTGACTCTGGAAGG - Intergenic
952898247 3:38093471-38093493 TCCTGCAAGCTCACACTGGAGGG - Intronic
955032732 3:55236856-55236878 TCAAGCAGGCCTCCACAGTAGGG + Intergenic
955064461 3:55522674-55522696 TCATGCAGACCTACAAGGGCAGG - Intronic
957490700 3:80923231-80923253 TTATTCAGTCCTACACTTGAGGG - Intergenic
960004879 3:112771877-112771899 TCCTACAGTCCTACTCTGGATGG - Intronic
962893560 3:139693810-139693832 TCACATAGGCCTACACTGAACGG - Intergenic
964425681 3:156551459-156551481 TCATGTGGGCCTCCACTGTATGG - Intronic
966064194 3:175796789-175796811 TAATTCAGGCTTACAATGGATGG + Intronic
969898611 4:10327916-10327938 TCATGCAGGCCGACCTGGGAGGG + Intergenic
978052807 4:104223352-104223374 TGAGGCAGGAATACACTGGAGGG - Intergenic
982557354 4:156884312-156884334 TCATGCAAGCCTCGACTGGCTGG - Intronic
987666170 5:20943421-20943443 TAATTCAGGCCTACAATGAAGGG - Intergenic
987712614 5:21521776-21521798 TCACCCAGGGCTTCACTGGATGG + Intergenic
988301765 5:29438715-29438737 TCACCCAGGGCTTCACTGGATGG - Intergenic
988756515 5:34258746-34258768 TAATTGAGGCCTACACTGAAGGG + Intergenic
991762974 5:69940929-69940951 TCACCCAGGGCTTCACTGGATGG + Intergenic
991784352 5:70177200-70177222 TCACCCAGGGCTTCACTGGATGG - Intergenic
991842201 5:70815969-70815991 TCACCCAGGGCTTCACTGGATGG + Intergenic
991876799 5:71177584-71177606 TCACCCAGGGCTTCACTGGATGG - Intergenic
997225997 5:132209981-132210003 CCATGCAGGACTACACAGGGTGG - Intronic
998930241 5:147173510-147173532 TCATGCAGGCACACATTGCATGG - Intergenic
1004320536 6:14628293-14628315 TCATGGAGGGCTTCACTGGCAGG - Intergenic
1009005039 6:57774609-57774631 TCACCCAGGGCTTCACTGGATGG - Intergenic
1011703745 6:89980704-89980726 CCCTGCTGGCCTCCACTGGAAGG + Intronic
1018551529 6:165003645-165003667 TCTTGAAGGCCTACACTGCTGGG + Intergenic
1025922216 7:65924035-65924057 TCATGCACTGCTATACTGGAAGG - Intronic
1028020708 7:85767850-85767872 TCAAGGAAGCCTACAATGGAAGG - Intergenic
1031344920 7:120653064-120653086 TCAACCAGGCCTAGACTGGAGGG + Intronic
1034941610 7:155234271-155234293 TCAGTCAGGGCTCCACTGGAGGG + Intergenic
1034975704 7:155448354-155448376 TCCTGGATGCCTCCACTGGAAGG - Intergenic
1034982837 7:155489669-155489691 TCGTGGGGGCCTACCCTGGAGGG - Intronic
1038716449 8:29995417-29995439 TCATGCAGCCCAAGACTGCATGG - Intergenic
1045293092 8:100850560-100850582 TCTTGCAGGCCTGCTGTGGAAGG - Intergenic
1050376776 9:4982527-4982549 CCATGCTGGCCAACACTGGAAGG + Intergenic
1050720167 9:8579786-8579808 TCATGCAGACGTACCTTGGAAGG + Intronic
1055051711 9:71988126-71988148 TCATGCACTCCTACACTTAAAGG - Intergenic
1059324966 9:113498423-113498445 TCAAGCAGGCCTAACCTGGGAGG - Intronic
1060260809 9:122072081-122072103 TCATGCAGGCCTACACTGGAAGG - Intronic
1060779468 9:126400845-126400867 TCATGCCTGCCTACCCTGGACGG - Intronic
1062051476 9:134449484-134449506 GCATGCAGGGCAACACTTGATGG + Intergenic
1062481647 9:136755159-136755181 TCATGCTGGCCTATCCTGCAGGG - Exonic
1186535613 X:10344055-10344077 TCATGCAGGACTCCAGTTGAAGG + Intergenic