ID: 1060264428

View in Genome Browser
Species Human (GRCh38)
Location 9:122102209-122102231
Sequence CAAGCTAATCTCCCAGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060264428_1060264434 18 Left 1060264428 9:122102209-122102231 CCTGTCCCTGGGAGATTAGCTTG No data
Right 1060264434 9:122102250-122102272 AGGATAGCACCCCCTTGTCTTGG No data
1060264428_1060264436 20 Left 1060264428 9:122102209-122102231 CCTGTCCCTGGGAGATTAGCTTG No data
Right 1060264436 9:122102252-122102274 GATAGCACCCCCTTGTCTTGGGG No data
1060264428_1060264435 19 Left 1060264428 9:122102209-122102231 CCTGTCCCTGGGAGATTAGCTTG No data
Right 1060264435 9:122102251-122102273 GGATAGCACCCCCTTGTCTTGGG No data
1060264428_1060264431 -2 Left 1060264428 9:122102209-122102231 CCTGTCCCTGGGAGATTAGCTTG No data
Right 1060264431 9:122102230-122102252 TGAAGCTGCCATCAGCCTCAAGG No data
1060264428_1060264443 30 Left 1060264428 9:122102209-122102231 CCTGTCCCTGGGAGATTAGCTTG No data
Right 1060264443 9:122102262-122102284 CCTTGTCTTGGGGGGATGAATGG No data
1060264428_1060264437 21 Left 1060264428 9:122102209-122102231 CCTGTCCCTGGGAGATTAGCTTG No data
Right 1060264437 9:122102253-122102275 ATAGCACCCCCTTGTCTTGGGGG No data
1060264428_1060264438 22 Left 1060264428 9:122102209-122102231 CCTGTCCCTGGGAGATTAGCTTG No data
Right 1060264438 9:122102254-122102276 TAGCACCCCCTTGTCTTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060264428 Original CRISPR CAAGCTAATCTCCCAGGGAC AGG (reversed) Intergenic
No off target data available for this crispr