ID: 1060269690

View in Genome Browser
Species Human (GRCh38)
Location 9:122131857-122131879
Sequence TCTCCAGGAAGCCCAGCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060269690_1060269700 6 Left 1060269690 9:122131857-122131879 CCACCCGCTGGGCTTCCTGGAGA No data
Right 1060269700 9:122131886-122131908 CCCTATGATTTGAGGCTGGGGGG No data
1060269690_1060269696 3 Left 1060269690 9:122131857-122131879 CCACCCGCTGGGCTTCCTGGAGA No data
Right 1060269696 9:122131883-122131905 GTTCCCTATGATTTGAGGCTGGG No data
1060269690_1060269694 -2 Left 1060269690 9:122131857-122131879 CCACCCGCTGGGCTTCCTGGAGA No data
Right 1060269694 9:122131878-122131900 GATTCGTTCCCTATGATTTGAGG No data
1060269690_1060269702 12 Left 1060269690 9:122131857-122131879 CCACCCGCTGGGCTTCCTGGAGA No data
Right 1060269702 9:122131892-122131914 GATTTGAGGCTGGGGGGAAGAGG No data
1060269690_1060269704 18 Left 1060269690 9:122131857-122131879 CCACCCGCTGGGCTTCCTGGAGA No data
Right 1060269704 9:122131898-122131920 AGGCTGGGGGGAAGAGGCATGGG No data
1060269690_1060269703 17 Left 1060269690 9:122131857-122131879 CCACCCGCTGGGCTTCCTGGAGA No data
Right 1060269703 9:122131897-122131919 GAGGCTGGGGGGAAGAGGCATGG No data
1060269690_1060269697 4 Left 1060269690 9:122131857-122131879 CCACCCGCTGGGCTTCCTGGAGA No data
Right 1060269697 9:122131884-122131906 TTCCCTATGATTTGAGGCTGGGG No data
1060269690_1060269706 20 Left 1060269690 9:122131857-122131879 CCACCCGCTGGGCTTCCTGGAGA No data
Right 1060269706 9:122131900-122131922 GCTGGGGGGAAGAGGCATGGGGG No data
1060269690_1060269695 2 Left 1060269690 9:122131857-122131879 CCACCCGCTGGGCTTCCTGGAGA No data
Right 1060269695 9:122131882-122131904 CGTTCCCTATGATTTGAGGCTGG No data
1060269690_1060269698 5 Left 1060269690 9:122131857-122131879 CCACCCGCTGGGCTTCCTGGAGA No data
Right 1060269698 9:122131885-122131907 TCCCTATGATTTGAGGCTGGGGG No data
1060269690_1060269705 19 Left 1060269690 9:122131857-122131879 CCACCCGCTGGGCTTCCTGGAGA No data
Right 1060269705 9:122131899-122131921 GGCTGGGGGGAAGAGGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060269690 Original CRISPR TCTCCAGGAAGCCCAGCGGG TGG (reversed) Intergenic
No off target data available for this crispr