ID: 1060271689

View in Genome Browser
Species Human (GRCh38)
Location 9:122147585-122147607
Sequence ACAAACCTGCACATGCTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060271687_1060271689 11 Left 1060271687 9:122147551-122147573 CCCTTCTGTTCTTTAATTAGCTA 0: 1
1: 0
2: 1
3: 35
4: 370
Right 1060271689 9:122147585-122147607 ACAAACCTGCACATGCTAGAAGG No data
1060271688_1060271689 10 Left 1060271688 9:122147552-122147574 CCTTCTGTTCTTTAATTAGCTAA 0: 1
1: 0
2: 1
3: 18
4: 310
Right 1060271689 9:122147585-122147607 ACAAACCTGCACATGCTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060271689 Original CRISPR ACAAACCTGCACATGCTAGA AGG Intronic
No off target data available for this crispr