ID: 1060274351

View in Genome Browser
Species Human (GRCh38)
Location 9:122171211-122171233
Sequence CCGTCAGGGCAGAAGCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060274344_1060274351 24 Left 1060274344 9:122171164-122171186 CCTAGCATTCTCTCTCTATAGCA 0: 1
1: 0
2: 1
3: 16
4: 223
Right 1060274351 9:122171211-122171233 CCGTCAGGGCAGAAGCCTCCAGG No data
1060274346_1060274351 -6 Left 1060274346 9:122171194-122171216 CCTGCACAAGTCAACCTCCGTCA 0: 1
1: 0
2: 0
3: 7
4: 56
Right 1060274351 9:122171211-122171233 CCGTCAGGGCAGAAGCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060274351 Original CRISPR CCGTCAGGGCAGAAGCCTCC AGG Intronic
No off target data available for this crispr