ID: 1060276778

View in Genome Browser
Species Human (GRCh38)
Location 9:122188514-122188536
Sequence TGGACCGAAGGGGCCCCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060276778_1060276789 5 Left 1060276778 9:122188514-122188536 CCTGCCGGGGCCCCTTCGGTCCA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1060276789 9:122188542-122188564 CACTTGCAGCCAGGGATTAGGGG No data
1060276778_1060276788 4 Left 1060276778 9:122188514-122188536 CCTGCCGGGGCCCCTTCGGTCCA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1060276788 9:122188541-122188563 CCACTTGCAGCCAGGGATTAGGG No data
1060276778_1060276792 22 Left 1060276778 9:122188514-122188536 CCTGCCGGGGCCCCTTCGGTCCA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1060276792 9:122188559-122188581 TAGGGGCCAAAAGAAGCAGAGGG No data
1060276778_1060276783 -4 Left 1060276778 9:122188514-122188536 CCTGCCGGGGCCCCTTCGGTCCA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1060276783 9:122188533-122188555 TCCATCGTCCACTTGCAGCCAGG No data
1060276778_1060276785 -3 Left 1060276778 9:122188514-122188536 CCTGCCGGGGCCCCTTCGGTCCA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1060276785 9:122188534-122188556 CCATCGTCCACTTGCAGCCAGGG No data
1060276778_1060276791 21 Left 1060276778 9:122188514-122188536 CCTGCCGGGGCCCCTTCGGTCCA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1060276791 9:122188558-122188580 TTAGGGGCCAAAAGAAGCAGAGG No data
1060276778_1060276786 3 Left 1060276778 9:122188514-122188536 CCTGCCGGGGCCCCTTCGGTCCA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1060276786 9:122188540-122188562 TCCACTTGCAGCCAGGGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060276778 Original CRISPR TGGACCGAAGGGGCCCCGGC AGG (reversed) Intronic
900550654 1:3252756-3252778 TGGACCGTGGGGGTCCCAGCTGG + Intronic
902501524 1:16914411-16914433 CGGAGCGAGGGGACCCCGGCCGG - Intronic
902916174 1:19640971-19640993 TGGACCCCAGGGGCCCCAGCGGG - Intronic
903435109 1:23343833-23343855 GGGAGCGAAGCGGCTCCGGCGGG + Intronic
903943854 1:26949837-26949859 AGGAAGGAAGGGGCCCTGGCAGG + Exonic
905800223 1:40838255-40838277 GGGACCGGAGGGGACGCGGCCGG - Intronic
906607751 1:47183467-47183489 GGGACCGAGGGGGCCCAGGCTGG - Intergenic
914875544 1:151511009-151511031 AGGACAGAAAGGGCCCTGGCCGG + Intronic
917749093 1:178038084-178038106 TGGACCGGAGCTGCCCCGCCGGG - Intergenic
1074204188 10:111267839-111267861 TCAACGGAAGGGGCCCCGGAGGG - Intergenic
1075940447 10:126387157-126387179 TGGACCGACAGCGCCCCGGGCGG + Intronic
1077008663 11:370444-370466 TTCACCGAAGGCGCCCCCGCCGG - Intronic
1079250431 11:18783110-18783132 TGCCCCGAAGGGGCCCCAGGAGG + Intronic
1084192512 11:67505349-67505371 GGGACTGCAGGGGCGCCGGCGGG - Exonic
1084904379 11:72334670-72334692 TGGCCCGAAGGGGCCCTGGGTGG - Intronic
1085523235 11:77150211-77150233 TGGTCTGCAGGGGGCCCGGCGGG - Intronic
1090608772 11:128451766-128451788 CGGAGGGAAGGGGGCCCGGCCGG - Intergenic
1091985603 12:4908743-4908765 TGGAAAGCAGGGGCCCCTGCGGG - Intergenic
1092245490 12:6861760-6861782 TGGAACCAAGGGGCCCTGGTAGG + Intronic
1097281181 12:57846238-57846260 TGGACCGGAGGGGTCCAGTCGGG + Intronic
1102477863 12:113200535-113200557 TGGGCCGAGGGGGCCCCTGGTGG - Intronic
1102527091 12:113519974-113519996 AGGAGCGAAGGGGCTCAGGCAGG + Intergenic
1103779551 12:123389517-123389539 TGGAGCGGAGGGGCCCGGGGAGG + Exonic
1105217534 13:18297771-18297793 TGGAGCGGAGGGGCCCGGGGAGG + Intergenic
1107831036 13:44373928-44373950 TGGGCCGCGGGGGCCTCGGCGGG + Exonic
1108582330 13:51838045-51838067 TGGACAGAAAGGACCCCAGCAGG + Intergenic
1108732123 13:53246093-53246115 TGGTCCGAAGGGGCAATGGCAGG - Intergenic
1112205042 13:97316339-97316361 TGGACCGAAGGGGCCAGAGGTGG - Intronic
1112898913 13:104335871-104335893 TGAACAGACGGGGCCCCTGCAGG - Intergenic
1113855707 13:113444367-113444389 AGGACCGCAGGGTCCCCAGCAGG + Intronic
1119727781 14:76932623-76932645 CAGATCAAAGGGGCCCCGGCAGG - Intergenic
1121013800 14:90536320-90536342 TGTCCCGAAGTGGCCCCGTCAGG + Exonic
1123139575 14:106062085-106062107 TGGTCCCAAGGGACCCCTGCAGG + Intergenic
1123187899 14:106537746-106537768 TGGTCCCAAGGGACCCCTGCAGG + Intergenic
1125003407 15:34794631-34794653 TGGACTGAAGGGGTCCCGAGTGG + Intronic
1125529859 15:40406037-40406059 TGGGCCGATGGGGACCAGGCAGG - Intronic
1125748573 15:42013619-42013641 TGGATGGAAGAGGCCCTGGCTGG - Intronic
1128916072 15:71563763-71563785 TGGAAAAAAGGGGCCCTGGCTGG - Intronic
1132661585 16:1063730-1063752 TGGACCGCAGATGCCCCGCCAGG - Intergenic
1134243362 16:12522051-12522073 TGGCCCCGAGGGGCCCCTGCTGG + Intronic
1136032554 16:27514251-27514273 GGGACGGCAGGAGCCCCGGCGGG - Intronic
1136923500 16:34350741-34350763 TGGAAAGAAGGGGCCTCAGCAGG - Intergenic
1136981073 16:35061065-35061087 TGGAAAGAAGGGGCCTCAGCAGG + Intergenic
1141431493 16:83972489-83972511 TGGACCAGAGGAGCCCGGGCTGG + Intronic
1141797971 16:86287285-86287307 GGCACCAGAGGGGCCCCGGCAGG - Intergenic
1143174682 17:4949248-4949270 GGGACAGAAGTGGCCCCGGTGGG - Intronic
1144519557 17:15944964-15944986 TGGACCGGAGGGGCCCCGCGCGG + Exonic
1148049008 17:44759997-44760019 TGTACAGAAGGGGACCCTGCGGG - Intronic
1148698744 17:49576052-49576074 TGGACCGAAGGGGGCGGGGTCGG + Exonic
1150337646 17:64342265-64342287 TGGACCTGAGGGGCCACGGATGG + Intronic
1151627218 17:75284503-75284525 TGCACTGAAGGGGTCCCTGCAGG - Intronic
1152357404 17:79813731-79813753 TGGGCTGCAGGGGCCCCCGCCGG - Intergenic
1152597699 17:81245984-81246006 TGGACAGCAGGGCCACCGGCTGG - Exonic
1152735542 17:81995297-81995319 TGGCCCGGAGGGGCCCTGGGGGG + Intronic
1152770477 17:82165265-82165287 TGGACTGTAGGGGCTCCGTCGGG - Intronic
1159704912 18:71674823-71674845 TGGACCAAAGGGGCACCTGCAGG + Intergenic
1160937317 19:1603000-1603022 TGGACTGCAGGGTCCCCAGCTGG + Intronic
1161265364 19:3361124-3361146 TGGCCCGAGGGGGTCCTGGCTGG + Intronic
1161980305 19:7626754-7626776 TGGACCCGTGGGGCCCAGGCTGG - Intronic
1163251268 19:16127675-16127697 TGCACCCAAGAAGCCCCGGCTGG - Intronic
1164578255 19:29418614-29418636 TGGAGGGGAGGGGCCCGGGCTGG + Intergenic
1167040981 19:47022239-47022261 CAGACCTGAGGGGCCCCGGCGGG + Intronic
1167609021 19:50497305-50497327 GGGACCGCAGAGGCCCCGGAGGG + Intergenic
927183872 2:20468190-20468212 TGGGCCTTTGGGGCCCCGGCAGG + Intergenic
934296773 2:91748882-91748904 TGGAGCGGAGGGGCCCGGGGAGG - Intergenic
937305806 2:120869864-120869886 TGGACTGAAGGTCCCCCTGCAGG - Intronic
938066211 2:128283300-128283322 TGGACAGAAGGGGCCCTGGTAGG + Intronic
945293514 2:208147921-208147943 TGGTCAGAAGGGACCCCTGCAGG + Intergenic
946058374 2:216920359-216920381 AGGACCGAAGGGGCCAGGACTGG + Intergenic
947476213 2:230449741-230449763 AGGAGCCAAGGGGCCCTGGCTGG + Intronic
948511173 2:238466276-238466298 AGGACCGAGGGGCCCCGGGCGGG + Intergenic
1168801905 20:648859-648881 TGGATCAAAGGGGCCCAGGGAGG - Exonic
1168958002 20:1848249-1848271 TGGACTGGAGGGGCCCAGGGTGG + Intergenic
1172313206 20:33933776-33933798 TGGACCGGCTGGGCCCTGGCTGG - Intergenic
1172884347 20:38221318-38221340 TGGACAGGAGGGGCCTGGGCTGG + Intronic
1175198416 20:57262324-57262346 TGAACTTAAGGGGCCCAGGCTGG + Intronic
1178263868 21:31124537-31124559 TGCACTGAAGGGGGCCAGGCCGG - Exonic
1181570912 22:23767513-23767535 TGGCCCGAAGGGGCGGGGGCTGG + Exonic
1184460176 22:44633388-44633410 TGGATCTATGGGGCCCCTGCTGG - Intergenic
953897340 3:46812404-46812426 TGGCTCGAAGAGGCCCGGGCAGG - Exonic
954362706 3:50130649-50130671 TGGACAGAGGGAGCCCAGGCAGG + Intergenic
958142393 3:89578551-89578573 TGGACCGATGGGGTCTCAGCAGG + Intergenic
962263126 3:133927566-133927588 AGGCCCGAGGGCGCCCCGGCGGG + Intergenic
966885935 3:184378190-184378212 TGGGCAGAAGTGGCCCAGGCAGG - Intronic
975661042 4:76689411-76689433 TGGACTGAGCGGGCCCGGGCGGG + Intronic
981128488 4:141132922-141132944 CGGGCCGGAGGGGCCGCGGCCGG + Intronic
985817116 5:2135330-2135352 TGGAGGGAAGGGGGCCAGGCTGG + Intergenic
986041098 5:3994930-3994952 TGGAGGGAAGGTGCCCAGGCAGG - Intergenic
1002691425 5:181053167-181053189 TGGACCGACACGGCCCCCGCGGG + Intronic
1002792209 6:444949-444971 GGCACCGAGGGGGCCCCTGCAGG + Intergenic
1004492459 6:16129421-16129443 GGGCAAGAAGGGGCCCCGGCGGG + Intronic
1006788579 6:36684151-36684173 TGGGCCGAAGAGGCGGCGGCAGG - Exonic
1021639966 7:22727435-22727457 TGGACCGAAGGCGCCTGTGCCGG - Exonic
1026792928 7:73346484-73346506 TGGGCCCAAGGGGCCCCAGGAGG + Intronic
1029537828 7:101166390-101166412 TGGGCCGAAGGGGGCACAGCGGG - Intergenic
1032491810 7:132329463-132329485 TGGACCCCTGGGGCCCTGGCAGG - Intronic
1035704910 8:1668360-1668382 TGGTCCGAGGGGGCACCGGTGGG - Exonic
1039431687 8:37529802-37529824 TGCCCTGAAAGGGCCCCGGCTGG - Intergenic
1039527808 8:38231884-38231906 TGGACCGAGGGAGGCCAGGCTGG + Intronic
1041244773 8:55879877-55879899 TGGCCCGGAGGCGCCACGGCCGG - Exonic
1042737503 8:72005276-72005298 TGTCACGAGGGGGCCCCGGCAGG + Intronic
1055194614 9:73573489-73573511 TGGTTGGAAGGGGCCCCAGCAGG + Intergenic
1056663217 9:88559803-88559825 TGGCCAGAAAGGGCACCGGCCGG - Intronic
1060058741 9:120439654-120439676 GGGACAGAAGGGGCCCAGGATGG - Exonic
1060276778 9:122188514-122188536 TGGACCGAAGGGGCCCCGGCAGG - Intronic
1060741856 9:126104010-126104032 GGGGCCTAAGGGGCCCAGGCTGG - Intergenic
1062130762 9:134891867-134891889 GGGACCAAAGGGCCCCAGGCAGG - Intergenic
1062319674 9:135984639-135984661 AGGACCGAAGGGGCCTCAGAAGG - Intergenic
1062380212 9:136283516-136283538 TGGCCCGGAGGGACCCGGGCTGG - Intronic
1190325894 X:49206692-49206714 TGGATCCAAGGGGCCCCCACGGG - Intronic