ID: 1060277677

View in Genome Browser
Species Human (GRCh38)
Location 9:122194151-122194173
Sequence CCTGAAGTGCACCTGGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060277669_1060277677 18 Left 1060277669 9:122194110-122194132 CCGGAATAAAGACATCTTTCGGC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1060277677 9:122194151-122194173 CCTGAAGTGCACCTGGGTCCTGG No data
1060277672_1060277677 -6 Left 1060277672 9:122194134-122194156 CCAAAGATAGACCTAAACCTGAA 0: 1
1: 1
2: 0
3: 13
4: 148
Right 1060277677 9:122194151-122194173 CCTGAAGTGCACCTGGGTCCTGG No data
1060277670_1060277677 -4 Left 1060277670 9:122194132-122194154 CCCCAAAGATAGACCTAAACCTG 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1060277677 9:122194151-122194173 CCTGAAGTGCACCTGGGTCCTGG No data
1060277671_1060277677 -5 Left 1060277671 9:122194133-122194155 CCCAAAGATAGACCTAAACCTGA 0: 1
1: 1
2: 0
3: 10
4: 146
Right 1060277677 9:122194151-122194173 CCTGAAGTGCACCTGGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060277677 Original CRISPR CCTGAAGTGCACCTGGGTCC TGG Intronic
No off target data available for this crispr