ID: 1060279246

View in Genome Browser
Species Human (GRCh38)
Location 9:122204848-122204870
Sequence CCTCAAAGGCACAGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 672
Summary {0: 1, 1: 0, 2: 8, 3: 135, 4: 528}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060279236_1060279246 0 Left 1060279236 9:122204825-122204847 CCACCCTGCTGCCCCCCAGAGAA 0: 1
1: 0
2: 11
3: 611
4: 1211
Right 1060279246 9:122204848-122204870 CCTCAAAGGCACAGAGAAGAAGG 0: 1
1: 0
2: 8
3: 135
4: 528
1060279237_1060279246 -3 Left 1060279237 9:122204828-122204850 CCCTGCTGCCCCCCAGAGAACCT 0: 1
1: 0
2: 1
3: 27
4: 307
Right 1060279246 9:122204848-122204870 CCTCAAAGGCACAGAGAAGAAGG 0: 1
1: 0
2: 8
3: 135
4: 528
1060279233_1060279246 6 Left 1060279233 9:122204819-122204841 CCTGCCCCACCCTGCTGCCCCCC 0: 1
1: 0
2: 24
3: 222
4: 1891
Right 1060279246 9:122204848-122204870 CCTCAAAGGCACAGAGAAGAAGG 0: 1
1: 0
2: 8
3: 135
4: 528
1060279238_1060279246 -4 Left 1060279238 9:122204829-122204851 CCTGCTGCCCCCCAGAGAACCTC 0: 1
1: 0
2: 0
3: 19
4: 273
Right 1060279246 9:122204848-122204870 CCTCAAAGGCACAGAGAAGAAGG 0: 1
1: 0
2: 8
3: 135
4: 528
1060279234_1060279246 2 Left 1060279234 9:122204823-122204845 CCCCACCCTGCTGCCCCCCAGAG 0: 1
1: 0
2: 6
3: 79
4: 783
Right 1060279246 9:122204848-122204870 CCTCAAAGGCACAGAGAAGAAGG 0: 1
1: 0
2: 8
3: 135
4: 528
1060279235_1060279246 1 Left 1060279235 9:122204824-122204846 CCCACCCTGCTGCCCCCCAGAGA 0: 1
1: 0
2: 5
3: 48
4: 1017
Right 1060279246 9:122204848-122204870 CCTCAAAGGCACAGAGAAGAAGG 0: 1
1: 0
2: 8
3: 135
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060279246 Original CRISPR CCTCAAAGGCACAGAGAAGA AGG Intronic
900001820 1:18649-18671 CCTCCAGGGCACACAGAGGATGG + Intergenic
900021540 1:189172-189194 CCTCCAGGGCACACAGAGGATGG + Intergenic
900652407 1:3736350-3736372 CCTCCGAGGCACAGGGCAGAGGG - Intergenic
900750306 1:4391480-4391502 CACCAATGGCACAGAGATGAGGG - Intergenic
902175652 1:14648521-14648543 CATCTAAGGGACAGAGAGGAGGG - Intronic
903660777 1:24976916-24976938 CCACAAAGTCAAAGAGAACAGGG - Intergenic
903670846 1:25034475-25034497 CCTCAGAGGGACAGTGAAAATGG + Intergenic
903776332 1:25796425-25796447 CGTCCCAGGCACGGAGAAGAGGG - Intergenic
904836054 1:33337409-33337431 CCTTAAACTCACAGAGAACAAGG + Intronic
904896619 1:33822742-33822764 CCTCTAAGGCACCCAGAAGGTGG + Intronic
905394384 1:37657707-37657729 CCTCCAAGCTACAGGGAAGAAGG + Intergenic
905446238 1:38030058-38030080 CCTCAAAGGGAGTGAGGAGATGG - Intergenic
905488568 1:38325670-38325692 CCTCAAATGCACAGGTCAGAGGG - Intergenic
905709284 1:40087128-40087150 CCACAAGGGCAGAGAGAACAGGG - Intronic
906056638 1:42923259-42923281 CTTCAGAGGCCCAGAGGAGAAGG + Intergenic
907046765 1:51304451-51304473 GCTCAGAGTCACAGAGAAAAGGG + Intronic
907393671 1:54175020-54175042 CAGCAGAGGCACAGGGAAGAGGG + Intronic
907547458 1:55274709-55274731 CTTCTAAGGCATGGAGAAGAGGG - Intergenic
907663292 1:56413289-56413311 CCTCAAAATCCCAGAGAGGATGG + Intergenic
907699083 1:56765785-56765807 TCTGAAAGGTAGAGAGAAGAAGG - Intronic
907842576 1:58171610-58171632 CTTCAAAGGCAAAGAGAAACTGG - Intronic
907989107 1:59561834-59561856 CCTCAAAGGCCTAGAGGAAAGGG + Intronic
908071011 1:60460208-60460230 CCTCAAAAGCACAGGCAAGGGGG + Intergenic
908300639 1:62758236-62758258 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
908659554 1:66422185-66422207 CCTCAAAGGCAAAGAGAAACTGG + Intergenic
910087595 1:83421648-83421670 CTACAAAGGGAAAGAGAAGAAGG - Intergenic
910250871 1:85198000-85198022 CCTCAAAGTTGCAAAGAAGATGG - Intronic
910397223 1:86805179-86805201 CCTCAAAGGCAAAGAGAAACTGG + Intergenic
911129555 1:94374839-94374861 CCTCAAAGGCAAAGAGAAACTGG + Intergenic
911190895 1:94947461-94947483 CCTCAAAAAAACAGAGAAGGTGG + Intergenic
911611634 1:99964912-99964934 ACTCAAAGGCAGAGAGAAAGAGG + Intergenic
912014432 1:105015384-105015406 CCTGAACTGCACAGAGAAAAAGG - Intergenic
912021522 1:105112999-105113021 CCTCAAAGACAAAGAGAAATTGG - Intergenic
912450300 1:109764131-109764153 CCTAAAAGGCAGAGGGAAGAGGG - Intronic
912459117 1:109819464-109819486 CCACAGAGCCACAGGGAAGATGG - Intergenic
913011314 1:114686653-114686675 CCTCAACAGGAAAGAGAAGAAGG + Intronic
913355578 1:117917804-117917826 GCTGAAAGGAACAGAGAAGCTGG - Intronic
913469757 1:119176279-119176301 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
915360154 1:155281367-155281389 CCTCAAAGAAAAAAAGAAGAAGG - Intronic
916083895 1:161254352-161254374 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
916114666 1:161476545-161476567 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
916119831 1:161519232-161519254 CCTGAAAGCCACAGACAATATGG + Exonic
916139088 1:161677712-161677734 CCTGAAAGCCACAGACAATATGG + Exonic
917086348 1:171308820-171308842 CCTCAAAGGGAAAGAGAAACTGG - Intergenic
918486896 1:185038765-185038787 CATGAATGGCATAGAGAAGAAGG + Intergenic
918552651 1:185761197-185761219 ACTCAAAGGCAAAAAGGAGATGG + Intronic
918663119 1:187114211-187114233 ACTCATAGGCACAGAGTAGGAGG + Intergenic
919206502 1:194425973-194425995 CCTCCAAGGCAAAGAGAAACTGG - Intergenic
919558930 1:199094504-199094526 CCTCAAAAGCAAAGAGAAACTGG - Intergenic
920934621 1:210419453-210419475 CCTCAAAAGGAGAGAGAACAAGG - Intronic
921019927 1:211226166-211226188 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
921166637 1:212512870-212512892 ACTCAAAGGCAGAGAGAAGAGGG + Intergenic
921328701 1:214014090-214014112 GCACAAAGGCACGGAAAAGAAGG - Intronic
921685036 1:218080427-218080449 CCAAAAAGGCACAGACTAGATGG + Intergenic
921783828 1:219202159-219202181 CATCCAAGACACAGAGAATAAGG - Intronic
922084617 1:222334133-222334155 ACTCAAAGGCATAGAGCAAATGG + Intergenic
922174111 1:223181690-223181712 TCTGAAAGGCAGAGAGAAGGAGG + Intergenic
922718971 1:227890701-227890723 CCTCCAGGGCAGAAAGAAGAGGG + Intergenic
923068373 1:230540563-230540585 CCTCAAAGCCTCAGAGAAGTGGG + Intergenic
924442041 1:244094454-244094476 TCTCCTAGGCACTGAGAAGAGGG + Intergenic
924648397 1:245901742-245901764 TCTCCAAGGCACAGAGAAAGAGG + Intronic
1062768016 10:80207-80229 CCCCACAGGCACTGAGCAGAGGG + Intergenic
1062971235 10:1651081-1651103 CCCCAAAGCCACACAGAAGCCGG - Intronic
1063321476 10:5056259-5056281 CCTCAAAGGCAAAGAGGAACTGG + Intronic
1063377987 10:5565563-5565585 CACCAAAGGCGAAGAGAAGAAGG - Intergenic
1064490085 10:15846146-15846168 CCTCAAAGGTATAGAAAAGTAGG + Intronic
1064603330 10:17014868-17014890 CCTCAAAGGCAAAGAGAAACTGG + Intronic
1064642362 10:17427567-17427589 CCTCACAGTTACAGAGGAGAAGG + Intronic
1065082652 10:22142771-22142793 CCTCAAAGGCAAAGAGGAACTGG - Intergenic
1065469026 10:26057404-26057426 CCTGGAAGTCACAGAGAAGTTGG + Intronic
1066055188 10:31674150-31674172 CCTCAGAGCCTCAGGGAAGAGGG + Intergenic
1066226313 10:33386874-33386896 CCTGACAGGCAGAGGGAAGATGG + Intergenic
1066614347 10:37280672-37280694 CCTCAAAGGCAAAGAGAAACTGG + Intronic
1067192158 10:44080723-44080745 TCTGAAAGGTACAGAGAAGAAGG - Intergenic
1067570416 10:47367554-47367576 CCTAACAGGCACAGAGAGCAGGG - Exonic
1067725166 10:48764754-48764776 CCCCAAAGGCACATAGTAGGTGG - Intronic
1068500544 10:57836654-57836676 CCTCAAAGGAAAAGAGAAACTGG - Intergenic
1068723082 10:60269024-60269046 CCTGAATAGCACAGAAAAGATGG - Intronic
1069137110 10:64780839-64780861 CCTGAAAGGCAAAGAGAAACTGG + Intergenic
1069540650 10:69291477-69291499 TCCCAAAGGCCCAGTGAAGAAGG + Intronic
1070630435 10:78080936-78080958 CCCCACAGGCAGAGAGGAGAAGG + Intergenic
1071091271 10:81921932-81921954 CCACAAAAGGACAGAAAAGAAGG - Intronic
1072371430 10:94769399-94769421 CCTCAAAGGCAAAGAGAAAGTGG + Intronic
1073124977 10:101143480-101143502 CCTCCAATCCACAGAGCAGATGG - Intergenic
1073223323 10:101894674-101894696 CCCCAAAGGTTCAGAAAAGATGG - Intronic
1074044223 10:109821741-109821763 CCTTAGAGGAACAGGGAAGAGGG + Intergenic
1075146556 10:119887454-119887476 CCTCGAAGGCAAAGAGAAACTGG - Intronic
1075292833 10:121244797-121244819 GGTCAAAGGCACACAGAAGATGG + Intergenic
1075428437 10:122361035-122361057 CCTGACAGGCACTGGGAAGAGGG + Intergenic
1075428478 10:122361278-122361300 TCTCAAGGGCATAGTGAAGAGGG - Intergenic
1075477504 10:122748860-122748882 CCTCAAGGTAACAGAGATGATGG + Intergenic
1077299334 11:1839937-1839959 GCCCTAAGGCCCAGAGAAGATGG + Intronic
1078920762 11:15828075-15828097 CCACACAGCCACAGAGAAGCAGG + Intergenic
1079022523 11:16921367-16921389 CTTAAAAGTCACAGACAAGAAGG + Intronic
1079730982 11:23937610-23937632 CCTCAAAGGCAAAGAGGAACTGG + Intergenic
1079811434 11:25003337-25003359 CCTCAAAGGCAAAGAGAAACTGG + Intronic
1081421666 11:42878938-42878960 CCTCAAAGGCAAAGAGGAACTGG - Intergenic
1083048956 11:59760013-59760035 CCTCCCAGGTACAGAGAAGAGGG - Intronic
1084247559 11:67870279-67870301 CCTCAAAGTGACAGAGAGAATGG - Intergenic
1085219789 11:74864340-74864362 GCAAAAAGGCAGAGAGAAGATGG + Intronic
1085625116 11:78065908-78065930 CCTCAACGGGAGAGGGAAGAAGG - Intronic
1086317627 11:85610463-85610485 CCTCACAGGCAAAGAGAAACTGG - Intronic
1086432670 11:86750349-86750371 CCTCAAGTGTACAGTGAAGAGGG - Intergenic
1086998406 11:93386219-93386241 CCTCAATGGAACAGACAAGATGG - Intronic
1087113716 11:94500169-94500191 CCTGAAAGTCACAGAGCTGATGG + Intergenic
1087461628 11:98454834-98454856 CCTAACAGGCACTGAGAAGCAGG - Intergenic
1087683105 11:101236697-101236719 CCTCAAAGTCAAAGAGAAACTGG + Intergenic
1087972680 11:104504265-104504287 CCTAAAATGTACAAAGAAGACGG - Intergenic
1088107838 11:106225960-106225982 CCTCAGAGGCCCACAGGAGACGG - Intergenic
1088492777 11:110403353-110403375 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
1088611233 11:111579109-111579131 CCTCAAAGGCCCAGAGAAAATGG + Intergenic
1088739257 11:112753390-112753412 CCTGAGAGTAACAGAGAAGAGGG - Intergenic
1088842449 11:113638425-113638447 CCTCAGAGGCACACATAATAGGG + Intergenic
1089069904 11:115691533-115691555 ACTCAGAAGCACAGAGTAGAAGG + Intergenic
1089672662 11:120067331-120067353 CCTCAAAGACACACAGGAGGTGG - Intergenic
1090139668 11:124242390-124242412 CCTCATGAGCACATAGAAGATGG + Intergenic
1090277175 11:125428614-125428636 CCTCAAACGCCCATAGAAGGTGG - Intronic
1091374901 12:18754-18776 CCTCCAGGGCACACAGAGGATGG + Intergenic
1091573664 12:1713153-1713175 CCTCAAAGGCAAAGAGAAACTGG + Intronic
1093215947 12:16361358-16361380 CCTCAAGAGCACAGAGATGGTGG + Intronic
1093271717 12:17070633-17070655 CCTCAAATGCACAGATAAAATGG + Intergenic
1093345483 12:18035249-18035271 CCTCAAAGGCAAAGAGGAACTGG - Intergenic
1093646567 12:21591808-21591830 CCTCACAGGCCAGGAGAAGATGG + Intronic
1094188284 12:27668591-27668613 ACTCAAAGGAACAGAGATAATGG - Intronic
1097160778 12:57045171-57045193 CCAGAAAGGCACACAGAATATGG - Intronic
1097355970 12:58602362-58602384 TCTGAAAGACACAGAGCAGATGG + Intronic
1097903636 12:64898109-64898131 GCTGCAAGGCACAGAGAAGCTGG - Intergenic
1098003172 12:65967442-65967464 GCCCAAGGGCAGAGAGAAGACGG + Intergenic
1098387329 12:69933340-69933362 ACTCAAAGGCCCAGAGAAGACGG - Intronic
1099331391 12:81293648-81293670 CGGCAAGGGCACAGAGAAAAGGG + Intronic
1100210034 12:92390568-92390590 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
1100297544 12:93276588-93276610 CCACAAAAGCACAGACTAGATGG - Intergenic
1101240640 12:102834791-102834813 CAGCAAAGGCACAGAGCAGCTGG - Intergenic
1101551325 12:105765046-105765068 CCTTAAAGGCACACACAAAAGGG - Intergenic
1101779752 12:107824674-107824696 CCTCAAAAGCAAAGAGAAACTGG - Intergenic
1101895632 12:108754368-108754390 CATCAAATGGACAGAGCAGATGG - Intergenic
1102140223 12:110608862-110608884 GATAAAAGGCACAGAAAAGAAGG - Intergenic
1102146581 12:110659079-110659101 CATCACAGCCACAGAGAAGCTGG + Intronic
1102160553 12:110765161-110765183 CCACAAAGTCACAAAGCAGAGGG + Intergenic
1102215747 12:111160447-111160469 ACACACAGGCACAGAGATGAAGG - Intronic
1103613950 12:122140607-122140629 CATCAAAGGCACAGAGCAGGTGG - Intronic
1104306407 12:127614204-127614226 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
1104464113 12:128976780-128976802 CCTCAAAGCCATAGAACAGAAGG - Intronic
1105602753 13:21901820-21901842 TCTGAAAGGCACAGCCAAGAGGG - Intergenic
1105639995 13:22252512-22252534 CCGCAAGAGCACAGAGATGACGG - Intergenic
1105762727 13:23528806-23528828 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
1105771243 13:23614101-23614123 TATCAGAGGCACAGAGAGGAGGG - Intronic
1105988028 13:25588775-25588797 CCCCCAAGGCACTGAGAGGATGG + Intronic
1106162942 13:27216684-27216706 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
1106278184 13:28235470-28235492 AAGCAAAGGCACAGAGATGATGG - Intronic
1106590423 13:31093745-31093767 GCTCTAAGGCCCGGAGAAGAAGG - Intergenic
1106689074 13:32094543-32094565 ACTCATAGACACAGAGTAGAAGG - Intronic
1106895741 13:34300426-34300448 CCTCAAAGGCAGAAAGAGAAAGG + Intergenic
1107258998 13:38468119-38468141 TCTGAAAGGTAGAGAGAAGATGG - Intergenic
1107400334 13:40063233-40063255 CCACAAACCCACAGAGAAGTGGG - Intergenic
1108848842 13:54704209-54704231 CCTCAAAGGCAAAGGGAAACTGG - Intergenic
1109821627 13:67664629-67664651 CCTGAAGGGCAGAGAGAAGAGGG + Intergenic
1109826907 13:67733457-67733479 ACCCAAATGCTCAGAGAAGAAGG - Intergenic
1109863548 13:68231767-68231789 ACCCATAGGCACAGATAAGAAGG - Intergenic
1110308406 13:74017795-74017817 AGTGAAAGGCACAGAGAAGCAGG + Intronic
1110380524 13:74844981-74845003 CATCTAAGGGAAAGAGAAGAAGG + Intergenic
1112519369 13:100082241-100082263 CCTCAAAGGCAAAGAGGAACTGG - Intergenic
1112538621 13:100284760-100284782 CCTCAAAGGCAAAGAGGAACTGG - Intronic
1112562923 13:100529724-100529746 CCTCAAAACCACAGAGAGGGAGG + Intronic
1112841168 13:103579954-103579976 CCTCAAGGACACAGTCAAGAAGG + Intergenic
1113203692 13:107893345-107893367 CCTCAAAGGCAAAGAGAAGCTGG + Intergenic
1113298130 13:108984730-108984752 CCTGAGGGTCACAGAGAAGATGG - Intronic
1114174581 14:20309209-20309231 ACTTAAAAGCACAGAGAAGCTGG + Intergenic
1115285219 14:31707974-31707996 CCTCAAAGGCAAAAAGAAACTGG + Intronic
1115307479 14:31947292-31947314 CCTCAGATGCACAGACATGAGGG - Intronic
1115429194 14:33296907-33296929 CCTCTAAGGGACAAAGAACAGGG + Intronic
1115490368 14:33952492-33952514 CCTCAGAGGCAGAGAGGAGAGGG - Intronic
1116388779 14:44365862-44365884 CCCCAAGGGCACAGGCAAGATGG + Intergenic
1116962968 14:50985907-50985929 CCTTCAAGGCACAGAGATCAAGG + Intronic
1117168536 14:53066462-53066484 CTACAAAGGCTCAGAGAAGAAGG + Intronic
1118362711 14:65069606-65069628 TATCAAGGGCACAGAGATGAAGG + Intronic
1118693321 14:68360779-68360801 ACCCAAAGGCCCAGGGAAGATGG + Intronic
1119343069 14:73897303-73897325 CTTTAAAGGAACAGGGAAGAAGG + Intronic
1119379355 14:74218672-74218694 CCCCAAAGGGACAGCCAAGAAGG + Intergenic
1119383770 14:74244655-74244677 CCTCCCAAGCACAGAGAAGAGGG - Intronic
1119847635 14:77842416-77842438 CCTGAAAGATACAGGGAAGAAGG - Intronic
1120187991 14:81414445-81414467 CGCCAAATGGACAGAGAAGATGG + Intronic
1120219460 14:81715710-81715732 TGTCCAGGGCACAGAGAAGATGG - Intergenic
1120221848 14:81743170-81743192 CATCAAGAGCAAAGAGAAGATGG - Intergenic
1120396676 14:83975889-83975911 ACTCAAGGGCAGAGAGAAGGAGG - Intergenic
1120454334 14:84713117-84713139 CCTCAAAGACACAAGAAAGAGGG + Intergenic
1120469779 14:84908051-84908073 ACAGAAAGACACAGAGAAGAAGG - Intergenic
1121021367 14:90582213-90582235 CCTCAGAGGCAGAGAGAGGGGGG - Intronic
1121600180 14:95197593-95197615 GGCCAAAGGCACAGTGAAGATGG - Intronic
1121876849 14:97460680-97460702 CCTTCAGGGCAGAGAGAAGATGG + Intergenic
1121954928 14:98205092-98205114 TCTGAAAGGCATGGAGAAGAAGG + Intergenic
1122879345 14:104683136-104683158 CCTCAAAGACACAGAGACCTGGG + Intergenic
1123807146 15:23886593-23886615 CCTCAAAGCCACAGAATAGAAGG + Intergenic
1123945789 15:25238292-25238314 ACTGAAAGACACAGGGAAGAAGG - Intergenic
1126071856 15:44872451-44872473 CCTCAAAGGCAAAGAGAAACTGG + Intergenic
1126086407 15:45014535-45014557 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
1126969913 15:54099189-54099211 ACTCTTAGGCACAGAGAAGCTGG - Intronic
1127485189 15:59412140-59412162 ACTCAGAGGAACAGAGAAGCTGG - Intronic
1128923028 15:71629468-71629490 CCTGAAAGACACAGGGAACACGG - Intronic
1128949778 15:71865641-71865663 GCTCAGAGGAAGAGAGAAGAGGG + Intronic
1130159445 15:81384123-81384145 CCTCACAAGCAGAGAGAGGAAGG - Intergenic
1130882094 15:88064079-88064101 ACACAGAGACACAGAGAAGAAGG + Intronic
1130905271 15:88235652-88235674 CCACAGTGTCACAGAGAAGAAGG + Intronic
1131090040 15:89617113-89617135 TCTGAAAGGCAGAGAGAAGAAGG - Intronic
1131464737 15:92646025-92646047 CCTGAAGGGCATAGAGAAGGGGG - Intronic
1131532158 15:93203031-93203053 CCTCTTGGGCAGAGAGAAGAAGG - Intergenic
1132451689 15:101972291-101972313 CCTCCAGGGCACACAGAGGATGG - Intergenic
1132455203 16:18338-18360 CCTCCAGGGCACACAGAGGATGG + Intronic
1132456911 16:29163-29185 CCCCACAGGCACTGAGCAGAGGG + Intergenic
1132750714 16:1456170-1456192 CCGCAGAGACACAGAGAAGCGGG - Exonic
1133363465 16:5192431-5192453 CCTCCAAGGCAGAGTGAAGTGGG - Intergenic
1135339430 16:21633509-21633531 CCTCAAAGGCAAAGAGAAACTGG + Intronic
1137827035 16:51507321-51507343 CCTCAAAGTCACACAGCAAAGGG - Intergenic
1138153742 16:54683992-54684014 CCCCAAAGGCACAGATCAGGTGG + Intergenic
1138389250 16:56658245-56658267 ACACAGAGGCACAGAGAGGAAGG - Intronic
1138394276 16:56692055-56692077 TCTCATAGGCCCAGACAAGAAGG - Intronic
1138494424 16:57398962-57398984 CCTCAAAGGCAAAGAGAAACTGG + Intergenic
1138923838 16:61566782-61566804 CCTCAAAGCCTCAGAAAATAGGG + Intergenic
1139229724 16:65272151-65272173 CTTCAAAGGCATGGAGAAGGGGG + Intergenic
1140537202 16:75720635-75720657 CCTGAAAGTCACAGAGAGAATGG + Intronic
1140712224 16:77689194-77689216 CCTCAAAGGAACTGGGGAGATGG - Intergenic
1140777499 16:78263413-78263435 CCTGAAGTGCACAGAGAAGAGGG + Intronic
1140941258 16:79723480-79723502 CTTTAAAGGCACAGAGAAAACGG - Intergenic
1141284237 16:82656219-82656241 GTTCAAAGGCACAGGGTAGAAGG + Intronic
1141323208 16:83031528-83031550 ATTCAAAGGCACAGGGATGAGGG - Intronic
1141806428 16:86344734-86344756 GCTCACAAGCACTGAGAAGATGG + Intergenic
1141966955 16:87452133-87452155 CCACAAAGTGACAGATAAGATGG + Intronic
1142236018 16:88922933-88922955 CAGCAAAGGCCCAGAGAGGAAGG + Intronic
1142262487 16:89049513-89049535 CCTCACAGGCCCAGGGAGGAGGG - Intergenic
1143294921 17:5863771-5863793 CCTCCAAGACACTGACAAGACGG - Intronic
1144092492 17:11870570-11870592 TCTCAAAGCCACACAGAAGCTGG - Intronic
1144946155 17:18970516-18970538 CCCCTGAGGCACAGAGAAGAGGG - Exonic
1145804339 17:27715751-27715773 CCCCAAAGGCAAAGAGAAACTGG - Intergenic
1145995473 17:29102560-29102582 ACACAAAGACACAGAGAACAAGG + Intronic
1146310744 17:31766438-31766460 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
1146453620 17:32993366-32993388 CCTCAAAGTGGAAGAGAAGAGGG + Intronic
1147414627 17:40279567-40279589 CCTAAAGAGCACAGAGAAAATGG + Exonic
1147607845 17:41784549-41784571 CCACCTTGGCACAGAGAAGAGGG + Intronic
1148772439 17:50075260-50075282 CCTTAAAGCCAAAGAGAACAGGG - Intronic
1148785920 17:50146187-50146209 CCTCAGAAGGACAGAGAAGGTGG + Intronic
1149074130 17:52577149-52577171 CCTCAAAGGCAAGGAGAAACTGG - Intergenic
1149209932 17:54290458-54290480 CCTCAAAAGCAAAGAGAAACTGG - Intergenic
1149213478 17:54329116-54329138 CCTCAAAGGCAAAGAAAAACTGG - Intergenic
1149471999 17:56924517-56924539 CATCAAAGGGACAGAGACAAGGG + Intergenic
1149604352 17:57914398-57914420 CCTCTAAGGCACAGGGAGCAAGG - Intronic
1150203881 17:63385746-63385768 CCTCAAGGCCAGAGAGAATATGG + Intronic
1150440744 17:65189533-65189555 CCTCGAAGGCACAGAGCTGAGGG + Intronic
1150458612 17:65328370-65328392 CCTTAAAGGTACAGACAAAAAGG - Intergenic
1150604349 17:66678176-66678198 AATTACAGGCACAGAGAAGAAGG + Intronic
1151428694 17:74048283-74048305 CCACAAAACCACAGAGAGGATGG + Intergenic
1151432401 17:74072377-74072399 CCTCAGAGGCACAGGGGAGAAGG - Intergenic
1151433325 17:74079655-74079677 CTTCCAAGGCACAGAGCAGAGGG - Intergenic
1151568261 17:74912322-74912344 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
1152106893 17:78335448-78335470 TTTCAAAAGGACAGAGAAGAGGG - Intergenic
1152498064 17:80688555-80688577 GCTCAAAGGGAGAAAGAAGAAGG + Intronic
1155712901 18:28904852-28904874 ACTCTAAGGCAAAGAGCAGAAGG + Intergenic
1156065156 18:33133105-33133127 TCTCAAAAGCACTGAGAAGAAGG + Intronic
1156889498 18:42174434-42174456 TTTGAAAGGCACAGAGAAAAGGG - Intergenic
1156931149 18:42645154-42645176 ACTCAAAGGCAGATAGGAGAGGG - Intergenic
1156953847 18:42937447-42937469 CCTCAGAGGTACAGCGGAGAAGG + Intronic
1157365544 18:47061050-47061072 CCTCAAAGGCACAATGTAGATGG + Intronic
1157500921 18:48190099-48190121 CACCCAAGGCAGAGAGAAGAGGG - Intronic
1158001700 18:52627008-52627030 TGTCAGAGGAACAGAGAAGAGGG - Intronic
1158789159 18:60754762-60754784 ACTCAAAGGCAGACAGAAGAGGG - Intergenic
1159170412 18:64758913-64758935 CCTCAAGGGAACAAAGAACAAGG + Intergenic
1160366893 18:78334119-78334141 TCTTCAAGGCACAGAGAAGCAGG - Intergenic
1160633572 19:60257-60279 CCTCCAGGGCACACAGAGGATGG + Intergenic
1161597987 19:5161968-5161990 CCTCAAAAGCAAAGAGAAACTGG + Intronic
1161914144 19:7216320-7216342 TCTCAAAGACAAAAAGAAGATGG + Intronic
1162237206 19:9318745-9318767 CCTCAAAGGCAAAGAGAAACTGG + Intergenic
1162528644 19:11222641-11222663 CGTGAAAGGGACAGAGATGAGGG + Intronic
1162796864 19:13091646-13091668 CCTCCCTGGCACAGAGCAGAGGG - Intronic
1163267818 19:16232255-16232277 CCACAAAGGCACAGTGAGAAGGG - Intronic
1163432546 19:17276867-17276889 CCACAATGGCACTGAGGAGAAGG + Exonic
1165192435 19:34076294-34076316 CCCCAAAGGCTCAGAGATTAGGG - Intergenic
1165359766 19:35329099-35329121 CCTCAGAGCCATAGAGAAGCAGG + Intronic
1165784009 19:38450433-38450455 TCTCACAGCCACAGAGAACAAGG + Intronic
1165847316 19:38826677-38826699 CCTCAAAGGCAAAGAGAAACTGG - Intronic
1166297745 19:41897149-41897171 CCCCCAGGGCACAGAGCAGAGGG - Intronic
1166391036 19:42409054-42409076 CCTGAAAGTCAGAGAGAGGATGG + Intronic
1166407738 19:42533336-42533358 CCTCAGAGAGACAGAGAAAACGG - Intronic
1167322793 19:48806796-48806818 CCTCAGACCCATAGAGAAGAAGG + Intronic
1168179342 19:54650267-54650289 CCTCCAGGGCACAGACAAGGTGG - Intronic
925926412 2:8674111-8674133 ACTCAAAAGCACAGTGGAGAGGG + Intergenic
925949664 2:8898745-8898767 CCTCAAAGGCAAAGAGAAACTGG + Intronic
927177366 2:20420056-20420078 GCTCACAGGAACAGGGAAGATGG + Intergenic
928268071 2:29829363-29829385 CCTAGAAGGCACAAAGAATATGG - Intronic
928534546 2:32227376-32227398 CCTCCAAGGAACAGAGGAGGTGG - Intronic
928617387 2:33054025-33054047 CCTCAAAGGCAAAGAGGAACTGG + Intronic
929798921 2:45082841-45082863 CCTCAAATGAACAGACAACAGGG - Intergenic
930038765 2:47104553-47104575 CCTCAAAGGCAAAGAGGAACTGG - Intronic
930335290 2:50038186-50038208 CCACAATGTCACAGAGTAGAGGG - Intronic
930424856 2:51199854-51199876 CCTCAGAGTAAGAGAGAAGAGGG + Intergenic
932586375 2:73032296-73032318 CAGCAGAGGCACAGAGGAGATGG - Intronic
934867358 2:97825061-97825083 CCTCAAAGACAAAGAGAAACTGG - Intronic
935129494 2:100250892-100250914 CCTCAAAGGGACTGTGCAGAGGG + Intergenic
935413329 2:102788464-102788486 CCTCAAGGTCACAGAGCTGAGGG - Intronic
936291584 2:111228425-111228447 ACTGAAAGATACAGAGAAGAAGG + Intergenic
936487886 2:112942410-112942432 TCTCAAGGGTACAGAGCAGATGG - Intergenic
936567900 2:113594758-113594780 CCTCCAGGGCACACAGAGGATGG - Intergenic
938633576 2:133196783-133196805 CCCCAAAGGATCAGAGAAGCAGG + Intronic
938805962 2:134807453-134807475 CCTCAAAGACAAAGAGAAACTGG + Intergenic
939344968 2:140952042-140952064 CTACAAAGGCACAGAGGAAATGG + Intronic
939534595 2:143411965-143411987 GCTCAAAGGCACAGAGCAAGAGG + Intronic
939852086 2:147315337-147315359 CCTCAAAGGCAAAAAGAAACTGG - Intergenic
940226553 2:151407354-151407376 CTTCAAAGACACAGAGAAGCTGG + Intergenic
940733878 2:157427127-157427149 CCTCATAGACACACAGAAGGAGG + Intronic
941020066 2:160398239-160398261 CCTCAAAGGAATATGGAAGATGG - Intronic
941749812 2:169122371-169122393 CCTCAAGGGCAAAGAGACAAAGG + Intergenic
942198568 2:173547692-173547714 CCTGAAAGGGAAAGAGAAGTGGG + Intergenic
942237452 2:173925660-173925682 CCTCAATGTCACAGGTAAGAAGG + Intronic
942783279 2:179671603-179671625 CATCATAGGCACACAGTAGAAGG + Intronic
943132317 2:183869648-183869670 CCTGAAATTCACAGAGTAGAGGG + Intergenic
943133984 2:183889400-183889422 TCTCAAAGGCAAAGAGAAACTGG - Intergenic
943264723 2:185714174-185714196 CCTCAAGGGTACAGAGAAAAGGG - Intergenic
944417305 2:199491646-199491668 ACGCAAGGACACAGAGAAGAAGG + Intergenic
944541345 2:200756694-200756716 CATCAAATGCACAGAGCTGAGGG + Intergenic
944587526 2:201185749-201185771 CCTGAAAGGGACAGAGAGGTGGG - Exonic
944729236 2:202500872-202500894 CCTCAAAAGCAAAGAGAAACTGG - Intronic
944989777 2:205222301-205222323 TCTCAAAGTCACACAGTAGAAGG + Intronic
945027069 2:205629682-205629704 ACTCAAAGGCACAGCCCAGAGGG - Intergenic
945447716 2:209957846-209957868 CCTCCAAGGAAAAGAAAAGAAGG + Intronic
946207138 2:218117977-218117999 CCTCAAAGGCAAAGAGAAACTGG + Intergenic
946248704 2:218400692-218400714 CCTCGGAGGCACAGAGAGGACGG + Intronic
946284692 2:218694137-218694159 CCTCCAAGGCACAAAGTTGATGG - Intronic
946623605 2:221587149-221587171 CTTCATATGCACAGAGAAAAGGG + Intergenic
946955995 2:224930613-224930635 CCTCAAAGTAAGAGAGAAAATGG + Intronic
947640285 2:231703807-231703829 CCTCTAAGAAACAGAGAGGACGG - Intergenic
947869272 2:233423940-233423962 CCTGAAAGGTAGAGAGAAGATGG - Intronic
948030881 2:234816505-234816527 CCTCAAGGGGACAGGAAAGATGG - Intergenic
948262559 2:236614954-236614976 CCCCAAAGCCACTCAGAAGAAGG - Intergenic
948726736 2:239938790-239938812 CCCAAACGGCACAGAGAAGACGG + Intronic
948790526 2:240374335-240374357 CCTCAAGGGACCAGAGAAGGAGG + Intergenic
948909688 2:240996784-240996806 CCCCAAATGCACTGAAAAGAGGG + Intergenic
1169027398 20:2382409-2382431 TATCAAAGGCCCAGGGAAGAGGG - Intronic
1169033337 20:2430380-2430402 CTTCAATGGCACTGGGAAGAAGG - Intronic
1169054920 20:2612647-2612669 GCACAGAGGCACATAGAAGAAGG - Intronic
1169151307 20:3291744-3291766 CCACATCAGCACAGAGAAGACGG + Intronic
1169666113 20:8038006-8038028 ACTCAAAGGAAAAGAGAAAAAGG + Intergenic
1169727659 20:8753508-8753530 AAGCAAAGGCATAGAGAAGAGGG - Intronic
1169760657 20:9089385-9089407 ACTTAAAAGCACAAAGAAGAAGG + Intronic
1170446205 20:16430561-16430583 TCTAAAAGGCACAGAGAAATTGG - Intronic
1171308325 20:24124996-24125018 CCTGCAAGGCAGAGAGAAGTTGG + Intergenic
1171335930 20:24385527-24385549 TCTGAAAGACCCAGAGAAGACGG + Intergenic
1171780314 20:29411258-29411280 TCCCAAAGGCTCAGAGAAGCAGG + Intergenic
1171938843 20:31304610-31304632 TGTGATAGGCACAGAGAAGACGG + Intronic
1172381246 20:34494226-34494248 TCTCAAAGGAAAAGAAAAGATGG + Intronic
1172643689 20:36456855-36456877 CCCCAAAGGAAGAGAGATGAAGG + Intronic
1173456231 20:43203970-43203992 TATCAAAAGCAAAGAGAAGATGG - Intergenic
1173507091 20:43596321-43596343 CCACAGAGGCTCAGAGATGAAGG - Intronic
1173801805 20:45898823-45898845 CCCCAGTGCCACAGAGAAGACGG - Exonic
1174306590 20:49617801-49617823 GCTCAAGGGCACCGAGGAGAGGG - Intergenic
1174429246 20:50456035-50456057 TCTCAAAGGCCCAGAGAAGTGGG - Intergenic
1174633931 20:51982628-51982650 CCTAAAAGATATAGAGAAGATGG + Intergenic
1175577712 20:60074952-60074974 CATCAAAAGCACAGAAGAGAGGG + Intergenic
1176168129 20:63685216-63685238 CCTCAGGGGCACAGAGAGGAGGG + Intronic
1177135289 21:17300730-17300752 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
1177420474 21:20850290-20850312 ACTCAAATGCTCAGAGAATATGG + Intergenic
1178354545 21:31899721-31899743 CCCAAAAGGGACTGAGAAGATGG - Intronic
1179344591 21:40545128-40545150 CCTACATGGCACAGAGCAGAAGG - Intronic
1179817130 21:43913739-43913761 CATCAAATGCACAGAGACCAGGG + Intronic
1180864172 22:19106339-19106361 CCACAAGGGCAAAGAGAGGATGG + Intronic
1181149159 22:20870360-20870382 CCTGGAGCGCACAGAGAAGATGG + Exonic
1181870879 22:25898375-25898397 CCTCAAGGTCACAGGTAAGATGG - Exonic
1181921091 22:26320994-26321016 CCTGAAAGACAGAGAGAAGATGG + Intronic
1182346621 22:29670985-29671007 CCTCTGACCCACAGAGAAGATGG - Intronic
1182847459 22:33443359-33443381 TCTAAAGGGCACAGAGAGGAAGG + Intronic
1182957682 22:34442608-34442630 ACACAGAGGCACAGAGAATAAGG - Intergenic
1183325973 22:37194509-37194531 CATCAAAGCCACAGAGAGAAAGG - Intronic
1183425330 22:37736010-37736032 CCTCTCAGACACAGAGAAGAGGG + Intronic
1184900484 22:47443791-47443813 CCCCAACTGCACAGAGAAAAGGG - Intergenic
1185156532 22:49196440-49196462 CCTGCAAGGCACAGAGCTGAAGG + Intergenic
949781165 3:7690229-7690251 ACTTAAAGGCACAAAGACGAAGG - Intronic
950866206 3:16191120-16191142 CCTCATAGTGAGAGAGAAGATGG - Intronic
951800193 3:26587207-26587229 CCTCACAGGCACAAGGGAGAAGG - Intergenic
951925839 3:27908123-27908145 CCTCATGGGAACAGAGAGGAGGG - Intergenic
952453260 3:33450604-33450626 CCTCAAAGGCAAAGAGGAACTGG - Intergenic
952834306 3:37590767-37590789 GCTCCCAGGCACAGAGATGAGGG + Intronic
952940728 3:38442480-38442502 CCTCAAAGGCAAAGAGAAACTGG + Intergenic
953251760 3:41250255-41250277 CCTGAAAGGCAGAGAAGAGAAGG + Intronic
953330833 3:42051697-42051719 CTTCAAAGGCTCAGAGGAGATGG + Intronic
953622709 3:44546962-44546984 CCTCAAAGACAAAGAGAAACTGG + Intergenic
954363761 3:50135724-50135746 ACTCAAAGGTTCAGAGAGGACGG + Intergenic
954455845 3:50599441-50599463 CCCCAATGTCACAGAGAAGATGG - Intergenic
954521064 3:51227016-51227038 CCTCAAAAACAGAGAGAAGCAGG - Intronic
954755064 3:52834754-52834776 CACCAAAGCCACATAGAAGAGGG + Intronic
954977035 3:54705983-54706005 CCTCAAAGGAGCACAGAAGCCGG - Intronic
955527381 3:59835448-59835470 CTGCAAAGACACAAAGAAGAAGG + Intronic
955928859 3:64035381-64035403 ACTCAAAGACACTAAGAAGACGG + Intergenic
956091530 3:65672616-65672638 TCTGTAAGGCACGGAGAAGAAGG + Intronic
956097046 3:65727763-65727785 CCTCAGAGAGACAGACAAGATGG + Intronic
956818003 3:72926072-72926094 CCTCAGGAGCACAGAGAAAATGG + Intronic
957583763 3:82109495-82109517 CCTGAAAGTGACAGAGAAAATGG - Intergenic
957861118 3:85951817-85951839 TGCTAAAGGCACAGAGAAGATGG + Intronic
958153642 3:89725137-89725159 TCTAAAAGACAAAGAGAAGAAGG + Intergenic
958549007 3:95591523-95591545 CCTCAAAGGCAAAGAGAAACTGG + Intergenic
959574467 3:107919444-107919466 CCTGAAAGTCACAGAGAACAGGG - Intergenic
959988742 3:112606719-112606741 ACTAAAAGGCTCAGAGAAGCCGG - Intronic
960145049 3:114192003-114192025 GCTCAATGGCAGAGAGAGGAGGG + Intronic
961047891 3:123721925-123721947 CCTCTTAGGGACAGAGGAGAGGG - Intronic
961270066 3:125681639-125681661 CCTCTTAGGGACAGAGGAGAGGG + Intergenic
961461142 3:127051131-127051153 CCTCCAGGGCACAGAGCAGTGGG - Intergenic
961787944 3:129358801-129358823 CCTCAGAGGCACAGCGCACATGG + Intergenic
962617692 3:137143646-137143668 CCTCATGGGCAAAGTGAAGATGG + Intergenic
963696973 3:148574792-148574814 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
963992069 3:151666977-151666999 CCTCAAAGGCAAATAGAAACTGG + Intergenic
964916749 3:161849720-161849742 CCTCAAAGGCAAAGAGGAACTGG + Intergenic
965062960 3:163805533-163805555 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
965139419 3:164815449-164815471 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
965785410 3:172330021-172330043 CCTCAAAAGCACTGGAAAGAAGG - Intronic
966105818 3:176332639-176332661 CCTCAAAGGTAGAGAGAAGAAGG + Intergenic
967394116 3:188987680-188987702 TCTGAAAGGCAGAGAGAAGAAGG - Intronic
967477080 3:189934570-189934592 TCTCAAAGGCATAGAGAACATGG - Intergenic
967583885 3:191189725-191189747 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
967941959 3:194773030-194773052 CCTCAAATGCAAATAGAATAAGG + Intergenic
968290781 3:197538054-197538076 CTTAAAAGGCAGAGAGAAGAAGG - Intronic
969339067 4:6529103-6529125 CCTCACAGGGACAGGGAAGGGGG + Intronic
970076342 4:12225454-12225476 TCTGAAAGGTACAGAGGAGAAGG + Intergenic
970423857 4:15928975-15928997 CCCCCAAAGCACAGACAAGAAGG + Intergenic
970777096 4:19688171-19688193 CTGAAAAGGCACAGTGAAGATGG + Intergenic
971280977 4:25242417-25242439 CCTCAAAGGCAAAGAGGAACTGG + Intronic
971444173 4:26724741-26724763 CCTCAAAGGCAGTCAGAAGTGGG + Intronic
971818634 4:31523043-31523065 TCTCAATGGCAGAGAGTAGAAGG - Intergenic
972133075 4:35861201-35861223 CCTAAAAGGCAAAGAGAAACTGG + Intergenic
973046069 4:45535399-45535421 CCTCAAAGTCAAAGAGAAACTGG - Intergenic
973173696 4:47177232-47177254 CTTCAAAGCCACAGATCAGATGG + Intronic
974174724 4:58308319-58308341 CCTCAAAGGCAAAGAGGAACTGG - Intergenic
974187540 4:58462055-58462077 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
974526770 4:63056813-63056835 CTTCAAAGGCAAAGAGAAACTGG - Intergenic
974537342 4:63188600-63188622 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
975217432 4:71771546-71771568 CCTCAAAACCACACAGAAGGTGG + Intronic
975349924 4:73333751-73333773 CCTCAAAGGAACTGAGTTGAGGG - Intergenic
975595603 4:76046218-76046240 CCTCAAAAGCAAAGAGAAACTGG + Intronic
975898935 4:79126990-79127012 CCTAGAAGTCACTGAGAAGATGG + Intergenic
977834715 4:101634316-101634338 CCTCAAAGGCAAAGAGGAACTGG + Intronic
977884299 4:102239267-102239289 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
978611605 4:110546756-110546778 CCTTAAAGGAAGTGAGAAGATGG + Intronic
980290684 4:130845260-130845282 CCCCAAAGGCAAAGAGAAACTGG + Intergenic
980545754 4:134259786-134259808 CTTCAAAGCCACAGAGTAGGAGG - Intergenic
980878509 4:138686261-138686283 CCTGGAAGGCACAGGGAGGACGG + Intergenic
981197989 4:141942893-141942915 CTTCCTAGGCACAGAGAGGAGGG - Intergenic
983834726 4:172373223-172373245 CCTCAAAGGCAAAGAGAAACTGG + Intronic
984842296 4:184079778-184079800 ACTCAGTGACACAGAGAAGAAGG - Intergenic
984917665 4:184738405-184738427 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
986758043 5:10855958-10855980 CCTCGGAGGCACAGAGAGGATGG - Intergenic
987545029 5:19303377-19303399 CCTCAAAGGCAACGAGAAACTGG + Intergenic
987818084 5:22930081-22930103 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
987857390 5:23438376-23438398 CCTCAAAGGCTCAGAGGTTAGGG - Intergenic
987930104 5:24391125-24391147 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
988326824 5:29779361-29779383 CCATAAAGGCAGAGAGAAGATGG + Intergenic
988358007 5:30201574-30201596 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
988738448 5:34045785-34045807 GGTCAATGGCAGAGAGAAGAAGG + Intronic
988869713 5:35375636-35375658 CTTAAAAGTGACAGAGAAGAAGG + Intergenic
989496388 5:42114828-42114850 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
989957554 5:50374304-50374326 CCTCAAAAGCAAAGAGAAACTGG - Intergenic
990495752 5:56346277-56346299 CCCCAAAGGCTCAGAGATTAGGG + Intergenic
991447640 5:66717196-66717218 CCTCCAAGCCACAGAGTATAGGG - Intronic
991466833 5:66922329-66922351 TCTTTAAGGCACAGAGAATAAGG - Intronic
992002849 5:72452245-72452267 CCTCAAAGGGAGAGAGAGGGAGG + Intronic
992049582 5:72930278-72930300 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
992227124 5:74629706-74629728 CCTCAAAGGGAGAGAAAAGCTGG - Exonic
992455412 5:76911467-76911489 CCTCAAAGGCAAAGAGAAACTGG - Intronic
992459931 5:76951509-76951531 CATCAATGGGAAAGAGAAGAGGG + Intergenic
992895686 5:81243221-81243243 CCAAAAAGGCACAGAGCACAAGG + Intronic
993597935 5:89882811-89882833 CCTGAAAAGTACATAGAAGAAGG - Intergenic
993722162 5:91332332-91332354 CCCCAATGGCTCAGAGAAAAAGG - Intergenic
994007532 5:94856915-94856937 CCTTAAAAGCAGAGAGAGGAAGG + Intronic
994231523 5:97314306-97314328 CCTCAAAGGCAAAGAGAAACTGG + Intergenic
994454231 5:99984593-99984615 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
995130990 5:108630310-108630332 TTTCACAGACACAGAGAAGAGGG + Intergenic
995229114 5:109738571-109738593 GCTCAAAGCCACACAGTAGATGG - Intronic
995583205 5:113621837-113621859 CCTCAAAGGCAAAGAGAAACTGG + Intergenic
995605082 5:113845520-113845542 CCTCAAAGGCACAGGGCTGAAGG - Intergenic
995706639 5:114994353-114994375 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
995789548 5:115870604-115870626 GCTCAAAGGCAGAAAGAAGCAGG - Intronic
995807259 5:116067034-116067056 TCTGAAAGGCAGAGAGAAGGAGG - Intergenic
996680423 5:126224138-126224160 CCTCAAAGTCAAAGAGAAACTGG - Intergenic
996770207 5:127077744-127077766 CCTGCCAGGCACAAAGAAGAAGG + Intergenic
996797836 5:127369514-127369536 CCTCAGAGTGACAGAGTAGATGG - Intronic
997195619 5:131977308-131977330 CCTCAAGGGCCCAGAGAACTAGG - Intronic
997360122 5:133289598-133289620 CCTCTAAGACACAGGGCAGAGGG + Intronic
998111668 5:139507292-139507314 CCTCAAAGGCAAAGAGAAGCAGG - Intergenic
998866836 5:146513925-146513947 CCTCAAATACAAATAGAAGATGG - Exonic
999037820 5:148373338-148373360 ATTCAAAGGTACAGAGTAGAGGG + Intergenic
999400109 5:151257900-151257922 CCACAAAGGAAAAGAGCAGAAGG - Intronic
1000085436 5:157883989-157884011 CCTCTAAGGCAAAGAGAAACTGG - Intergenic
1003566881 6:7229746-7229768 CCTCAAAGGCTCAGTGGAGGCGG + Exonic
1004153926 6:13150002-13150024 CCTCAAAAGCAGAGAGAGGCAGG - Intronic
1004531580 6:16459650-16459672 CCTCAAAGGCAAAGAGAAACTGG - Intronic
1004812452 6:19275189-19275211 CCTCAAAGGCAAAGAGGAACTGG - Intergenic
1005929207 6:30469208-30469230 CCTCAAAGGAGGAGTGAAGATGG + Intergenic
1005944476 6:30585422-30585444 ACTCACAGGCACAGTGGAGAAGG - Intronic
1006571900 6:35012528-35012550 CCCCTCAGGCCCAGAGAAGAAGG - Intronic
1007030243 6:38620371-38620393 CCTCAAAGGCAAAGAGAAACTGG - Intronic
1007694001 6:43720109-43720131 CATCAAAGGCAGAGCGCAGAGGG + Intergenic
1007834057 6:44660830-44660852 CCTCAAAGGGAAGCAGAAGATGG - Intergenic
1008142375 6:47846704-47846726 ACTGAAAGGAACACAGAAGAGGG - Intergenic
1008242195 6:49127388-49127410 CATCACAGGCCCAGAGGAGAAGG + Intergenic
1009264269 6:61533321-61533343 CCTCAAAGTGACAGGGAGGATGG + Intergenic
1009872984 6:69472096-69472118 CCTCAAAGGCAAAGAGGAACTGG - Intergenic
1010270028 6:73907773-73907795 CCTCAAAGCCAAAGAGAAACTGG - Intergenic
1011374846 6:86677418-86677440 CCTCAAAGGCAAAGAGAAACTGG + Intergenic
1012441340 6:99264838-99264860 CCTCAAAGGCAAAGAGAAACTGG + Intergenic
1013907643 6:115237181-115237203 CCTCAAAGGCAAACAGAAACTGG + Intergenic
1014108390 6:117592583-117592605 ACACACAGACACAGAGAAGAAGG - Intronic
1014202457 6:118621399-118621421 CCTCAAAGGCAAAGAGGAACTGG - Intronic
1014504938 6:122243186-122243208 CCTGAAAGGCACACTGAAGAAGG + Intergenic
1014812976 6:125906180-125906202 CCTTAAAAGTACAGAGAGGAGGG + Intronic
1015986574 6:138890350-138890372 CCTCAAAGGCACAGGGTAGCAGG + Intronic
1016564875 6:145441293-145441315 CCTAAACTGCACACAGAAGAAGG + Intergenic
1016903122 6:149121471-149121493 CCTGAAAGGTAGAAAGAAGAGGG + Intergenic
1017101158 6:150851012-150851034 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
1019899497 7:4008883-4008905 ACTCAAAGGAACAGAAAGGAGGG - Intronic
1020405477 7:7828696-7828718 CTTCAAAGGCAAAAAGGAGAAGG - Intronic
1021356389 7:19657058-19657080 CCTCAAAGGCAAAGAGAAACTGG + Intergenic
1021621394 7:22553830-22553852 TCTGAAAAGCACAGAGAAGGGGG + Intronic
1021756523 7:23858132-23858154 CCTCAAAGGCAAAGAGAAACTGG + Intergenic
1022065929 7:26857909-26857931 CCTCAAAGGAAGGTAGAAGAAGG - Intronic
1023182768 7:37501983-37502005 GAACAAAGGCTCAGAGAAGAAGG - Intergenic
1023495145 7:40787517-40787539 ACTGAAAGACAGAGAGAAGAAGG + Intronic
1024220795 7:47284922-47284944 ACTTAAAGGCAAAGAGAAAATGG - Intronic
1024355501 7:48410204-48410226 CTTCAAAGACAGAGAGAACAGGG + Intronic
1024564710 7:50671993-50672015 GAGCCAAGGCACAGAGAAGAAGG - Intronic
1024870584 7:53958740-53958762 CCTCAAAGGCAAAGAGAAACTGG + Intergenic
1026079617 7:67205937-67205959 TCTCAAAGGTAGAGATAAGAAGG - Intronic
1026697231 7:72606045-72606067 TCTCAAAGGTAGAGATAAGAAGG + Intronic
1027171019 7:75872506-75872528 CCTGACAGGCACAGAGAGGAAGG + Intronic
1027304474 7:76878127-76878149 CTACAAAGGGAAAGAGAAGAAGG - Intergenic
1027844617 7:83356833-83356855 CCTCAAATGCAGAAAGAAGAAGG + Intergenic
1028495026 7:91452362-91452384 CATCAAAGGCAAAGAGAAACTGG + Intergenic
1029176954 7:98671373-98671395 CCTCCTAGGCACACAAAAGACGG - Intergenic
1029422089 7:100477135-100477157 CCTGGCAGGCACAGAGAAGAGGG + Intronic
1029756672 7:102578203-102578225 CCCAAAAGCCACAGGGAAGAGGG + Intronic
1029923172 7:104287619-104287641 CCTTAAAAGAAAAGAGAAGAAGG - Intergenic
1030305817 7:108018254-108018276 CTCCACAGGCACAGAGAAGGGGG - Intergenic
1031347389 7:120685906-120685928 CCTCAAAGGGACATAGATAAAGG - Intronic
1031539345 7:122974743-122974765 CCACAAAGTCACAGAGTATAGGG - Intergenic
1031561405 7:123243131-123243153 CATCCAAGGGCCAGAGAAGATGG + Intergenic
1031913910 7:127544847-127544869 CCTGAAAGGCAGGGAGAAGCGGG + Intergenic
1031947135 7:127854026-127854048 CCTGAAAGGCAGAAAGCAGATGG - Intronic
1031984596 7:128155325-128155347 CCTGGAAGGCAGAGAGGAGAGGG + Intergenic
1032630489 7:133645437-133645459 CCACAAGGGCACAGAGGAAAAGG - Intronic
1033759035 7:144420952-144420974 CCTCAAAGGCAAAGAGAAACTGG + Intergenic
1033828739 7:145225951-145225973 CCTCAAAGGCACCCAAAAGAGGG + Intergenic
1034579769 7:152032298-152032320 CCTCAAAGGCAAAGAGAAACTGG + Intronic
1034984447 7:155499068-155499090 CCTCAAAGCCACAGGGCAGGGGG - Intronic
1035184740 7:157117522-157117544 CATCAAAGGCACAGAGGTGCAGG + Intergenic
1035817465 8:2556890-2556912 ACTCAAAGGATCAGAGTAGAAGG + Intergenic
1036613649 8:10371763-10371785 CCTCTTAGGCACAGCGGAGAAGG - Intronic
1036723108 8:11196320-11196342 CATAAAAGGCAAAGAGAAGTGGG + Intronic
1038090544 8:24248115-24248137 CCACAGTGGCACAGAGAAGGAGG - Intergenic
1038685007 8:29708358-29708380 ACTAAAAGGTATAGAGAAGAAGG - Intergenic
1039276197 8:35935959-35935981 CCTCAAAGGCAAAAAGAAACTGG - Intergenic
1039300636 8:36205154-36205176 CCCCAAAGGCTCAGAGGTGAAGG + Intergenic
1039594474 8:38778918-38778940 CCTCAAAGGCACAAAAAATTGGG - Intronic
1039692984 8:39881526-39881548 CCTCAAAGGCAAAGAGAAACTGG + Intergenic
1039849219 8:41347904-41347926 TCTCACAGCCACAGAGAACAAGG + Intergenic
1040588512 8:48766851-48766873 ACTCAAAGGTGGAGAGAAGAAGG + Intergenic
1040667677 8:49653043-49653065 CCTCAAAGACAAAGAGAAGCTGG + Intergenic
1040698354 8:50030372-50030394 CCTCAAAAGCACAGCGACCAAGG - Intronic
1040743526 8:50611261-50611283 ACTCAGAGGCAAAGGGAAGAAGG - Intronic
1040796632 8:51295304-51295326 CCTCAAAGGCAAAGAGAAACTGG + Intergenic
1040953604 8:52958620-52958642 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
1040962996 8:53054270-53054292 CCCAAAAGGCAGAGAGAAGAAGG - Intergenic
1040971263 8:53139609-53139631 CCTCAAAGGCAAAGAGAAACTGG + Intergenic
1041002112 8:53463553-53463575 CCTCAAAGGCAAAGAGAATCTGG - Intergenic
1041442899 8:57917449-57917471 TCTCAACAGAACAGAGAAGAGGG + Intergenic
1041742843 8:61175614-61175636 ATTTAAAGGCACAGGGAAGAAGG + Intronic
1042078867 8:65027412-65027434 CCTCAAAAGCCCAGACTAGAGGG - Intergenic
1042434853 8:68752020-68752042 CCTCATAGGCTCAGAGAATGTGG + Intronic
1042455660 8:68999518-68999540 TCTGAAAGGTAGAGAGAAGAAGG - Intergenic
1042772111 8:72391919-72391941 CCTCAAAGGCAAAGAAAAACTGG - Intergenic
1042919812 8:73909972-73909994 CCTCAAATGCAAAGAGAAACTGG - Intergenic
1043131789 8:76472034-76472056 CCTCACAGGAACAGAGAACAAGG - Intergenic
1043928851 8:86068324-86068346 CCCCAAACACACAGAGGAGAAGG + Intronic
1043950162 8:86299780-86299802 ACTCAAAGGCAGAGAGAAGAAGG - Intronic
1044005236 8:86930547-86930569 CCTCAAAGGCAAAGAGAAACTGG + Intronic
1044198142 8:89402800-89402822 CCCCAAAGAAACAGAGAATAGGG + Intergenic
1044456433 8:92396918-92396940 CCTCAAAGGCAAAGAGAAACTGG + Intergenic
1044595929 8:93958323-93958345 CCTTAAAACCACAGAGAAGGAGG - Intergenic
1044768535 8:95604165-95604187 CGTCAAAGGTCCAAAGAAGAAGG - Intergenic
1046653665 8:116869766-116869788 GCTGAAAGACACAGAGAAGCTGG + Intronic
1047166680 8:122446925-122446947 TCTCACAGACACAGAGGAGAAGG + Intergenic
1047360045 8:124160796-124160818 CCTCAAAGACAAATAGAATAGGG + Intergenic
1047360789 8:124167045-124167067 CCTGGAAGGTAGAGAGAAGATGG - Intergenic
1047712775 8:127568605-127568627 CCTCAACAGCACAAAGAAAAGGG + Intergenic
1048315055 8:133355628-133355650 CCTCAAGGGGCCAGAGCAGAGGG + Intergenic
1048869766 8:138787661-138787683 CAACCAAGGCTCAGAGAAGAGGG + Intronic
1048952001 8:139504304-139504326 CCACACAGGGACAGGGAAGAGGG - Intergenic
1049429583 8:142553922-142553944 CCTCATAAACACAAAGAAGAAGG - Intergenic
1049597645 8:143492151-143492173 CCTAAGAGGCACAGAGATGCAGG + Intronic
1049624034 8:143612157-143612179 CCTGAGAGCCACAGAGAGGAGGG + Intergenic
1049884628 9:18762-18784 CCTCCAGGGCACACAGAGGATGG + Intergenic
1051935467 9:22438515-22438537 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
1052057579 9:23921902-23921924 CCTCAAAGTCAAAGAGAAACTGG + Intergenic
1052289701 9:26827328-26827350 CCTCAAAGGCAAAGAAAAACTGG - Intergenic
1052460925 9:28762013-28762035 CCACAAAGGTACAGAATAGAGGG - Intergenic
1054722193 9:68615300-68615322 CATGAAAAGAACAGAGAAGAAGG + Intergenic
1055027328 9:71736127-71736149 CATCAAAGGCACAGAGATGAAGG - Intronic
1055037308 9:71831404-71831426 TCTAAAAGGGAGAGAGAAGATGG + Intergenic
1055443374 9:76358476-76358498 CCTCAAAGGAAGAGGCAAGAGGG - Intronic
1056297861 9:85210777-85210799 ACTCTAAGGCACTGAGAAGTGGG + Intergenic
1056392584 9:86153309-86153331 CCTCAAAGGCAAAGAGAAACTGG + Intergenic
1056619340 9:88197815-88197837 CCTGAAAGCCAGAAAGAAGAAGG - Intergenic
1056880154 9:90383832-90383854 ACTGAAAAGCACAGAGATGAAGG + Intergenic
1057941369 9:99288123-99288145 CCTCAAAGGAAAAGGGAAGGAGG + Intergenic
1058241051 9:102560520-102560542 TCTCAAAGTCACATAGAAAATGG + Intergenic
1058349926 9:104009471-104009493 TCTGAAAGGCACAGAGAGGAAGG - Intergenic
1058812673 9:108656504-108656526 CCTCAAGAGCATAGACAAGAAGG + Intergenic
1058832375 9:108830902-108830924 CTGGGAAGGCACAGAGAAGATGG + Intergenic
1059366562 9:113790985-113791007 ACTCTAGGGCACAGAGGAGAGGG - Intergenic
1059908148 9:119011653-119011675 CCTAAGGGGCACAGTGAAGAAGG + Intergenic
1060279246 9:122204848-122204870 CCTCAAAGGCACAGAGAAGAAGG + Intronic
1061199215 9:129126903-129126925 ACTGAAGGGGACAGAGAAGACGG - Intronic
1061693346 9:132353556-132353578 TCCTAAAGGGACAGAGAAGAAGG - Intronic
1062717036 9:138016263-138016285 CCACAAAGGCACAGAGAGCTTGG + Intronic
1186809020 X:13168719-13168741 CTTCACATGTACAGAGAAGAAGG + Intergenic
1186843264 X:13506256-13506278 CCCCAAAGGCTCAGAGATTAGGG - Intergenic
1187133923 X:16528754-16528776 ACTTAAAAGCACAGAGAAAAGGG + Intergenic
1188097722 X:26044087-26044109 CCTCGAAGGCAAAGAGAAACTGG - Intergenic
1189442340 X:41048667-41048689 ACTGAAAGGCAGAGAGAAAAAGG - Intergenic
1191955627 X:66639783-66639805 ACTCAGGGGCCCAGAGAAGATGG - Intergenic
1192148140 X:68695195-68695217 GCCCAAAGGCATGGAGAAGAAGG + Intronic
1192482559 X:71498238-71498260 CCTCAAAGGCAAAGAGAAACTGG + Intronic
1192907351 X:75565884-75565906 CCTGAAAGTCACGGAGAAAATGG - Intergenic
1193252459 X:79308260-79308282 ACTGAAAGAGACAGAGAAGAGGG + Intergenic
1193561203 X:83018125-83018147 GTTAAAAGGCACAGACAAGATGG + Intergenic
1194060458 X:89190336-89190358 ACACAAAGACACAGAGAAGCCGG - Intergenic
1194184245 X:90752992-90753014 ACTCAAAGCCACAGAGAAAAGGG + Intergenic
1195151448 X:102074218-102074240 CCCCAAAGGCACAAAGTAAAGGG + Intergenic
1195439765 X:104886724-104886746 CCTCAAAGGCAAAGAGAAACTGG - Intronic
1195641787 X:107183492-107183514 TCTGAAAGGTAGAGAGAAGAAGG + Intronic
1195882306 X:109604924-109604946 CCTGAAAGGGACAGAGAGAATGG + Intergenic
1197060026 X:122166892-122166914 ACTCAAAGAGACAGAGTAGAAGG + Intergenic
1197513601 X:127398984-127399006 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
1197863734 X:130996760-130996782 ACACAGAGACACAGAGAAGAAGG + Intergenic
1197931360 X:131699455-131699477 CTTCAAAAGCTCAGAGTAGAAGG + Intergenic
1197949633 X:131880563-131880585 GCTCAAAGGCGAAGAGAAGAAGG + Intergenic
1198151780 X:133917864-133917886 CCTCAAAGGGATAGAGCAGCTGG - Intronic
1198573202 X:137980507-137980529 CCAAACAGGCACAGTGAAGACGG - Intergenic
1199574109 X:149296915-149296937 CCACAGAGGCCCAGAGAGGAAGG - Intergenic
1199688640 X:150288796-150288818 CCTGAAAGGCACTGTTAAGAGGG + Intergenic
1199832209 X:151558246-151558268 CCTCAAAGGCAAAGAGGAACTGG + Intergenic
1200399449 X:156010560-156010582 CCCCACAGGCACTGAGCAGAGGG - Exonic
1200401176 X:156021389-156021411 CCTCCAGGGCACACAGAGGATGG - Intergenic
1200530836 Y:4334918-4334940 ACTCAAAGCCACAGAGAAAAGGG + Intergenic
1200834503 Y:7719838-7719860 CCACCAAGGCAGAGAGAATATGG - Intergenic
1200959483 Y:8983842-8983864 CCTCAAAGGCAAAGACAAGCTGG - Intergenic
1201175661 Y:11307237-11307259 TCTCAATGGCTCAGAGGAGAAGG - Intergenic
1201178058 Y:11321878-11321900 TCTCAAAGGCTCAGAGGAGCAGG - Intergenic
1201311873 Y:12604751-12604773 CCTCAAAGGCAAAAAGAAACTGG + Intergenic
1201407343 Y:13662394-13662416 CCTCAAAAGCAAAGAGAAACTGG + Intergenic
1201455304 Y:14162204-14162226 CCCCAAAGGCAAAGAGAAACTGG - Intergenic
1201473003 Y:14353955-14353977 CCTCAAAGACAAAGAGAAACTGG + Intergenic
1201527670 Y:14954281-14954303 CCTAAAAGGGACAGGGAAAATGG + Intergenic
1201530724 Y:14987422-14987444 TCTCAAAGGCAAAGAGAAACTGG - Intergenic
1201555930 Y:15264680-15264702 CCTCAAAGGCAAAGAAAAACTGG - Intergenic
1201568413 Y:15389874-15389896 CCTCAAAGGCAAAGAGAAACTGG + Intergenic
1201631436 Y:16075225-16075247 CCTCAAAGGCAAAGAGAAACTGG - Intergenic
1201640077 Y:16168904-16168926 CCTCAAAGGCAAAGAGGAACTGG + Intergenic
1201662736 Y:16416421-16416443 CCTCAAAGGCAAAGAGGAACTGG - Intergenic
1201729412 Y:17188664-17188686 CCTCAAAGGCAAAGAGAAATTGG + Intergenic
1201743821 Y:17349975-17349997 CCTCAAAGGCAAAGAGAAACTGG + Intergenic
1202038560 Y:20659848-20659870 CCTCAGGGGCATATAGAAGAAGG - Intergenic
1202192426 Y:22258930-22258952 CCTCAAAGGCAAAGAGAAACTGG + Intergenic
1202258066 Y:22941275-22941297 CCTCAAAGGCAAAGAGAAAGTGG - Intergenic
1202271852 Y:23080959-23080981 CCTCAAAGGCAAAGAGGAACTGG + Intergenic
1202294174 Y:23339723-23339745 CCTCAAAGGCAAAGAGGAACTGG - Intergenic
1202411056 Y:24575033-24575055 CCTCAAAGGCAAAGAGAAAGTGG - Intergenic
1202424849 Y:24714703-24714725 CCTCAAAGGCAAAGAGGAACTGG + Intergenic
1202445940 Y:24955382-24955404 CCTCAAAGGCAAAGAGGAACTGG - Intergenic
1202459725 Y:25095039-25095061 CCTCAAAGGCAAAGAGAAAGTGG + Intergenic