ID: 1060280086

View in Genome Browser
Species Human (GRCh38)
Location 9:122209802-122209824
Sequence GCAGAGATGAAACTGGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 245}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060280086_1060280089 -8 Left 1060280086 9:122209802-122209824 CCTGAAACCAGTTTCATCTCTGC 0: 1
1: 0
2: 2
3: 20
4: 245
Right 1060280089 9:122209817-122209839 ATCTCTGCCACTTACCTCCTGGG 0: 1
1: 0
2: 4
3: 50
4: 334
1060280086_1060280092 2 Left 1060280086 9:122209802-122209824 CCTGAAACCAGTTTCATCTCTGC 0: 1
1: 0
2: 2
3: 20
4: 245
Right 1060280092 9:122209827-122209849 CTTACCTCCTGGGTAGCCCTGGG 0: 1
1: 0
2: 2
3: 19
4: 182
1060280086_1060280091 1 Left 1060280086 9:122209802-122209824 CCTGAAACCAGTTTCATCTCTGC 0: 1
1: 0
2: 2
3: 20
4: 245
Right 1060280091 9:122209826-122209848 ACTTACCTCCTGGGTAGCCCTGG 0: 1
1: 0
2: 1
3: 11
4: 181
1060280086_1060280088 -9 Left 1060280086 9:122209802-122209824 CCTGAAACCAGTTTCATCTCTGC 0: 1
1: 0
2: 2
3: 20
4: 245
Right 1060280088 9:122209816-122209838 CATCTCTGCCACTTACCTCCTGG 0: 1
1: 0
2: 3
3: 48
4: 343
1060280086_1060280098 18 Left 1060280086 9:122209802-122209824 CCTGAAACCAGTTTCATCTCTGC 0: 1
1: 0
2: 2
3: 20
4: 245
Right 1060280098 9:122209843-122209865 CCCTGGGCAAGGTTTCAGTAGGG 0: 1
1: 0
2: 1
3: 15
4: 131
1060280086_1060280100 22 Left 1060280086 9:122209802-122209824 CCTGAAACCAGTTTCATCTCTGC 0: 1
1: 0
2: 2
3: 20
4: 245
Right 1060280100 9:122209847-122209869 GGGCAAGGTTTCAGTAGGGTTGG 0: 1
1: 0
2: 3
3: 55
4: 476
1060280086_1060280094 7 Left 1060280086 9:122209802-122209824 CCTGAAACCAGTTTCATCTCTGC 0: 1
1: 0
2: 2
3: 20
4: 245
Right 1060280094 9:122209832-122209854 CTCCTGGGTAGCCCTGGGCAAGG 0: 1
1: 0
2: 7
3: 33
4: 349
1060280086_1060280096 17 Left 1060280086 9:122209802-122209824 CCTGAAACCAGTTTCATCTCTGC 0: 1
1: 0
2: 2
3: 20
4: 245
Right 1060280096 9:122209842-122209864 GCCCTGGGCAAGGTTTCAGTAGG 0: 1
1: 0
2: 0
3: 10
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060280086 Original CRISPR GCAGAGATGAAACTGGTTTC AGG (reversed) Intronic
903002781 1:20278107-20278129 GCATAAATGAAAATGGCTTCTGG - Intergenic
903266231 1:22159722-22159744 TCAGAAATGAAGGTGGTTTCGGG + Intergenic
903876373 1:26476769-26476791 GCACAGATGAAACTTGTTGAAGG + Intergenic
904721918 1:32516666-32516688 GCAGGGATGGAAATGGTTTTGGG - Intronic
910769504 1:90816796-90816818 GTAGAGATGAGGCTGGATTCAGG - Intergenic
912526133 1:110284337-110284359 CCAGAGAGGAAACTGATTGCAGG + Intergenic
915130803 1:153694174-153694196 GCAGTGCTGAAACTGGTTTAAGG + Intergenic
915279581 1:154813508-154813530 ACAGAGGGGAGACTGGTTTCGGG - Intronic
915686474 1:157639453-157639475 GCAGAGGTGAAGCTGTCTTCTGG + Intergenic
916448185 1:164893293-164893315 GCAGAGATGGAATGGGATTCAGG + Intronic
916954114 1:169813840-169813862 CCTTAGATAAAACTGGTTTCCGG + Intronic
917597436 1:176543436-176543458 GCAGAGATGAAGCTGGAATGTGG - Intronic
917960940 1:180144031-180144053 GCAGAAAGGTAACTTGTTTCAGG + Intergenic
919410023 1:197231417-197231439 GTAGACATGAAACTGGATTCTGG + Intergenic
919937529 1:202264542-202264564 GCAGACATCAGGCTGGTTTCTGG - Intronic
1064036084 10:11914416-11914438 GCAGAGATGCAACATGTCTCAGG - Intergenic
1064036445 10:11917193-11917215 GCAGAGATGCAACATGTCTCAGG - Intergenic
1064284422 10:13980189-13980211 GCAGAGGTGTAAATGGTATCTGG + Intronic
1064579345 10:16778367-16778389 GCAGAGAGGAAACTGCTGGCTGG - Intronic
1064801016 10:19072075-19072097 GCAGATAAGAAAATGGTTGCTGG - Intronic
1066815939 10:39412685-39412707 ACAGAGATGAAACTTTTTTTTGG + Intergenic
1067522589 10:47019480-47019502 ATAGAGCTGAAAATGGTTTCAGG + Intergenic
1070667963 10:78358741-78358763 GCAGGGAAGAAGCTGGGTTCAGG - Intergenic
1074749592 10:116572032-116572054 GCAGACTTGGAATTGGTTTCTGG + Intergenic
1076684654 10:132192626-132192648 GCAGAGATTTCACTGGTTACAGG - Intronic
1077700478 11:4436854-4436876 GCAGATATGAAACTTGATTTCGG + Intergenic
1077916305 11:6613725-6613747 GAAAAGATGACACAGGTTTCTGG + Exonic
1078826803 11:14937700-14937722 GCAGAGGAGCAACTGGCTTCTGG + Intronic
1080040510 11:27754725-27754747 ATAGAGAGGAAAGTGGTTTCAGG + Intergenic
1080066792 11:28025955-28025977 GCAAATATGAAACTGCTTTGGGG + Intronic
1081508088 11:43739055-43739077 ACATAGATAAAACTGGTGTCAGG + Intronic
1083999035 11:66286072-66286094 ACAGGGACCAAACTGGTTTCTGG + Intronic
1085118431 11:73950927-73950949 GCAGAGCTGAAATTTGTTTAGGG + Exonic
1086981314 11:93200683-93200705 ACAGAGATGAGACTGGGCTCAGG + Intergenic
1087891775 11:103544203-103544225 GCAGAGCTGAAAGAGGTTTTGGG - Intergenic
1088756725 11:112891130-112891152 GAAGAGGTGAAACTGGTCTTAGG - Intergenic
1089048970 11:115529329-115529351 GCAGATATGAAGTTGGTATCAGG + Intergenic
1090251726 11:125256301-125256323 GCAGAGATAAAAAGGGCTTCAGG + Intronic
1091573325 12:1710639-1710661 GCAAAGAGGAAGCTGGTTCCAGG - Intronic
1091890313 12:4048570-4048592 GCAGGGATAAAACTGGAGTCTGG - Intergenic
1092629349 12:10361825-10361847 CTACAGATAAAACTGGTTTCTGG + Intergenic
1092997630 12:13964753-13964775 GCAAAGATGAAGCGGGTTTGGGG + Intronic
1093078215 12:14779154-14779176 GAAATAATGAAACTGGTTTCAGG + Intergenic
1094465037 12:30744098-30744120 GTAGAGCTGAGAGTGGTTTCAGG - Intronic
1095235731 12:39793346-39793368 GCAGAGATGTACCTTGTTTATGG + Intronic
1095453995 12:42363213-42363235 ACAGTGATGATACTGGTGTCAGG - Intronic
1096007113 12:48182753-48182775 GCAGAAACGAAACTGAATTCAGG + Intergenic
1096512747 12:52140729-52140751 GCAGAGGAGACCCTGGTTTCAGG + Intergenic
1097396691 12:59083678-59083700 GCTGAGATGAAAGGGTTTTCTGG + Intergenic
1098364877 12:69691839-69691861 GCAACTATAAAACTGGTTTCAGG - Intronic
1099185238 12:79509350-79509372 ACAGATATGTATCTGGTTTCTGG - Intergenic
1099608420 12:84834626-84834648 TCAGAGATGACACTATTTTCTGG - Intergenic
1102704148 12:114866746-114866768 GCAGAGGTGAAACTGGCCTTAGG - Intergenic
1103868349 12:124072146-124072168 GCAGACTTGGAAATGGTTTCAGG + Intronic
1104798626 12:131537617-131537639 CCTGTGAGGAAACTGGTTTCCGG + Intergenic
1105378862 13:19867924-19867946 TCTTAGATAAAACTGGTTTCAGG - Intergenic
1106336061 13:28784242-28784264 GCAGACATCAAACTAGCTTCAGG - Intergenic
1106821812 13:33473193-33473215 AGAGAGATGAATCTGGTGTCAGG + Intergenic
1107023321 13:35774398-35774420 GCAGAACTGAAAGTGTTTTCAGG - Exonic
1108723653 13:53158320-53158342 GCGGAGAGGAAATTGCTTTCTGG - Intergenic
1109482642 13:62975747-62975769 ACAGTGAAGAAACTGGTTACAGG - Intergenic
1112158515 13:96844456-96844478 ACAGAAATGCAACTGTTTTCAGG + Intergenic
1112184834 13:97117662-97117684 TCAGACATCAAACTGGTTTAGGG + Intergenic
1112537552 13:100275007-100275029 GAAGAGTTGACACTGTTTTCAGG - Intronic
1113409473 13:110072342-110072364 GCAGTGAGGAAGCTGGTCTCGGG + Intergenic
1113769719 13:112900301-112900323 GCAGAGATGAAGCAGGTGCCCGG + Intronic
1116269948 14:42750492-42750514 CCATAGATGAAACTGATTTTTGG + Intergenic
1116332440 14:43613139-43613161 GCAGCAATGAAGCTGGATTCAGG - Intergenic
1120720031 14:87880787-87880809 ACACAAATGAAGCTGGTTTCAGG + Intronic
1121006611 14:90494738-90494760 ACAGAGATGGAACTGGGCTCTGG - Intergenic
1123040871 14:105489745-105489767 GCTGAGGTGAGGCTGGTTTCTGG + Intronic
1123180548 14:106466220-106466242 GCTGAGCTGAAATCGGTTTCTGG - Intergenic
1202946351 14_KI270726v1_random:30441-30463 GCTGAGCTGAAATCGGTTTCTGG + Intergenic
1124023739 15:25945978-25946000 GCATAGTTGAGTCTGGTTTCAGG + Intergenic
1124200016 15:27671134-27671156 GCAAAGCTGAAAATGGTTTTAGG - Intergenic
1125089202 15:35770960-35770982 CCAGAGATGTGGCTGGTTTCAGG + Intergenic
1127592843 15:60444322-60444344 ACAGAAATTAAACTGGTTTTAGG - Intronic
1130391239 15:83457225-83457247 GAAGAGATGAAACTGGTCCCTGG - Intronic
1131953068 15:97702663-97702685 GAAGAGCTGAAAATGGTGTCAGG - Intergenic
1132364166 15:101244099-101244121 TCAGAGATGACACTGAATTCAGG + Intronic
1133323044 16:4926110-4926132 TCAGAGATGAAACCTGCTTCCGG - Intronic
1135052039 16:19201147-19201169 TGAGAGAGGAAATTGGTTTCTGG + Intronic
1137297542 16:47110495-47110517 GCAGAGATGAATCTGTTATTCGG + Intronic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1139731014 16:68945322-68945344 GCTAAGATAAAACTGGTTTTAGG + Intronic
1141394738 16:83694656-83694678 GCAGAGATTTACCTGGTTGCTGG - Intronic
1142893416 17:2959632-2959654 GAAGAGCTGAAACTGGAATCCGG + Intronic
1143480202 17:7223779-7223801 GAACAGATGAGACTGGTTTTGGG - Intronic
1144308597 17:13992081-13992103 GCAGAGGGGAAATTGATTTCTGG + Intergenic
1144331705 17:14230005-14230027 GGAGAGATGACACTGATTTTTGG + Intergenic
1145119172 17:20241200-20241222 GCAGAGAAGAAACTGGGTACAGG - Intronic
1145201724 17:20951555-20951577 GCAGAGAAGAAACTGGGCACAGG - Intergenic
1146820297 17:35979281-35979303 GCAGAGATGAAACTGGAGAGAGG + Intronic
1147439239 17:40437438-40437460 GGAGATATGAAACTGGATCCTGG + Intergenic
1148848979 17:50545345-50545367 GCAGAGATGACACTGCTTGGAGG - Intronic
1149562136 17:57615746-57615768 ACAAGGATGAAACTGGGTTCTGG - Intronic
1150089017 17:62304142-62304164 TCAGAAATGAAACTTCTTTCTGG - Intergenic
1151364780 17:73610091-73610113 GGGGAGATGACACTGGTCTCGGG + Intronic
1153421124 18:4906495-4906517 CTATAGATAAAACTGGTTTCAGG - Intergenic
1153714319 18:7830806-7830828 GCAGAGGTAAAAATGCTTTCGGG - Intronic
1154961900 18:21317730-21317752 GCAGAGCTGAAACTGACTGCAGG - Intronic
1156111663 18:33734979-33735001 GCAAAGGTGAAACTGCTTTCAGG - Intronic
1156443079 18:37211426-37211448 GGAGAGACGTAACTGGGTTCTGG + Intronic
1157040463 18:44033156-44033178 ACACAGAAGATACTGGTTTCTGG + Intergenic
1157168228 18:45378059-45378081 ATAGAGATTACACTGGTTTCTGG - Intronic
1157223395 18:45842540-45842562 GCAGACAGGAAACTGTTTACAGG + Exonic
1157487269 18:48097077-48097099 GAAGAGAGGAAACAGTTTTCAGG - Intronic
1158268998 18:55692342-55692364 AAAGAGTTGAAACTGCTTTCTGG - Intergenic
1158904012 18:61993536-61993558 GCCAAGATGAAGCTGGTGTCTGG + Intergenic
1160898353 19:1413492-1413514 GAAGAGATGACCCTGCTTTCCGG + Intronic
1163405267 19:17118083-17118105 GGAGAGATGCTACTGGCTTCTGG + Intronic
1164445638 19:28315597-28315619 CCAGAGGTGAAACTGGGTTGGGG - Intergenic
1164841857 19:31398691-31398713 GCACAGATGAGACTGCTCTCTGG + Intergenic
1165372674 19:35419325-35419347 GAAGAGTTGAAAGTGGCTTCAGG - Intergenic
1166382860 19:42363941-42363963 ACAGAGATGAACGTGGTCTCTGG - Intronic
925033215 2:667513-667535 GCACAGAGCACACTGGTTTCAGG - Exonic
925495512 2:4444900-4444922 GTAGAGATAAAACTGGTGTTAGG + Intergenic
927421813 2:22941837-22941859 GCAGCCATGTAACTGGGTTCTGG + Intergenic
928337135 2:30407740-30407762 GCAGAGCTGAGGCTGGTTCCTGG + Intergenic
929198102 2:39206953-39206975 GCAGAAATGACACTGGTAACAGG + Intronic
929302944 2:40326651-40326673 GAAGAGATGAAACAAATTTCTGG + Intronic
931021672 2:58051926-58051948 GAAGAAAGGAAACTGGTTTAGGG + Intronic
933770064 2:85737954-85737976 CCAGAGATGAGGCTGGCTTCAGG - Intergenic
933852975 2:86385684-86385706 GCAGAGAGGAACCTGGATGCGGG + Intergenic
938370804 2:130767290-130767312 GCAGCCATGAAATGGGTTTCTGG + Exonic
939119966 2:138104359-138104381 GTAGAAATTAAAGTGGTTTCAGG - Intergenic
939550050 2:143603981-143604003 GCACAAATAAAACTTGTTTCTGG + Intronic
940782096 2:157943528-157943550 GAGGAGATGAAAAGGGTTTCAGG + Intronic
941502323 2:166295167-166295189 GCAGAGATGAAGTTGGTGTGTGG + Intronic
942195302 2:173512127-173512149 CCTGAGATAAAACTGGTTTCAGG - Intergenic
942635538 2:178000184-178000206 GCAGAAATGAAACCATTTTCTGG - Intronic
943111222 2:183608416-183608438 GCCTAGATAAAATTGGTTTCTGG - Intergenic
943263916 2:185701065-185701087 TATTAGATGAAACTGGTTTCAGG - Intergenic
943528949 2:189054455-189054477 GCATACATAAAACTGTTTTCAGG + Intronic
943778285 2:191792349-191792371 GCAGAGCAGAATCAGGTTTCAGG - Intergenic
945489194 2:210434824-210434846 GCAGAGTTGTAACTGCTCTCGGG - Intronic
1169267519 20:4175681-4175703 GCAGAGATGAAAGGGGATTTTGG + Intronic
1169848913 20:10028545-10028567 ACACAGATGAAACTGTGTTCAGG + Intronic
1170218417 20:13916378-13916400 GCACAGATGTAACTTGTTTAAGG + Intronic
1171188157 20:23138057-23138079 TCTTAGATAAAACTGGTTTCAGG - Intergenic
1171403664 20:24895157-24895179 CCACAGATAAAACTGGTTTCAGG - Intergenic
1171483404 20:25469583-25469605 GCAGAGCTGAAGCTGTTATCAGG + Intronic
1171722215 20:28574520-28574542 TCAGAGATTCAACTTGTTTCTGG + Intergenic
1173670065 20:44792819-44792841 AAAGTGCTGAAACTGGTTTCTGG - Intronic
1174855712 20:54043240-54043262 GCACAGCTGAAATTGGTTACAGG + Intronic
1174934579 20:54853579-54853601 ACAGAGCAGAAACTGGTTTTTGG - Intergenic
1174981297 20:55398407-55398429 TCAGAGATGAACCTCTTTTCAGG + Intergenic
1178026981 21:28479236-28479258 GAAGAGATGAAAATGGAGTCAGG - Intergenic
1178570525 21:33731524-33731546 TCATAAATGAAACTGGCTTCTGG - Intronic
1181528092 22:23501599-23501621 GCAGAGATGTAACTGGCACCAGG - Intergenic
1182101027 22:27657447-27657469 GCAGAGAAGAGTCTGGCTTCAGG + Intergenic
1182942558 22:34291303-34291325 GCAGGGCTGAAGTTGGTTTCTGG + Intergenic
1183714388 22:39525268-39525290 GCAGAGATGAAGTTGATGTCTGG + Intergenic
1184812988 22:46849756-46849778 GCAGAGCTGACACTTGTATCCGG - Intronic
1184999016 22:48231041-48231063 GCAGAGATGACATGGGTTTGTGG - Intergenic
949904936 3:8851527-8851549 GCAGAGGTGGAACTGCTCTCAGG + Intronic
952082736 3:29780628-29780650 GCAGATAGGATACTGGTTTTTGG - Intronic
952084298 3:29798503-29798525 GAAGAGACAAAACTGATTTCAGG - Intronic
953194660 3:40721060-40721082 GCAGAGAGGGAACTGGAGTCTGG - Intergenic
955777814 3:62452232-62452254 GCAGAAATGACAATGATTTCTGG - Intronic
956510089 3:69984057-69984079 CCAGCCATGAAAGTGGTTTCAGG - Intergenic
957181363 3:76882291-76882313 GCAGAGGTGAAACAAGTATCTGG + Intronic
957282361 3:78170419-78170441 CCACAGAGGAAACTGGCTTCTGG - Intergenic
958111820 3:89157652-89157674 GCAGAGATGAAACTCTCTGCGGG + Intronic
961438158 3:126933478-126933500 GCTGAGAAGATGCTGGTTTCAGG - Intronic
962095214 3:132285769-132285791 GATGAGATAAAACTGGTTTCAGG + Intergenic
962637478 3:137345935-137345957 CCAGAGATGAGACCTGTTTCAGG + Intergenic
963679805 3:148360231-148360253 GCAAAGATGAAATTATTTTCTGG + Intergenic
965146829 3:164915552-164915574 TCAGAGATGAAACCTGCTTCTGG - Intergenic
965219655 3:165912400-165912422 GAAGAGAAGAAATTGGTTGCCGG - Intergenic
966447710 3:180021782-180021804 GGGGAGATGTAACTGGTTTGTGG + Intronic
967722536 3:192830582-192830604 GCAGAGAGATAACTGGTTTGGGG - Intronic
969714364 4:8861208-8861230 GCAGGGATGAACCTGGCTCCAGG + Intronic
969832960 4:9813258-9813280 TGAGAGATGAAACTGGTTGATGG - Intronic
970117712 4:12718063-12718085 GCAGAGATAAATCTGGGTTTGGG + Intergenic
970169347 4:13274389-13274411 GCAGATATCAAACTGGTATCTGG + Intergenic
970193903 4:13538244-13538266 GCTGAGTTGAGACTGGGTTCCGG - Intergenic
971516599 4:27494714-27494736 GCTGAGTTGAAGCTGTTTTCTGG + Intergenic
972338892 4:38133518-38133540 CCAGAGATGAACTTGGATTCAGG + Intronic
973938994 4:55884343-55884365 ATAGAAATGAAACTGGTTCCTGG + Intronic
975205205 4:71637711-71637733 GCAGTTATGAAAGTGGTTTATGG - Intergenic
975405107 4:73980287-73980309 CCAGAGATGGAAATGGTTTCTGG + Intergenic
976126519 4:81838903-81838925 GCAGAAAAGATAATGGTTTCTGG - Intronic
983299804 4:165910522-165910544 CCAGAGATGGAATTGGTTTTAGG - Intronic
983334597 4:166375720-166375742 CCAGAGAGAAAATTGGTTTCAGG + Intergenic
987175551 5:15304415-15304437 ACAGAAATGAAACTGGATTCAGG + Intergenic
990607436 5:57424339-57424361 GAAGTGAGGAAACTGGTTTTGGG - Intergenic
992208119 5:74451097-74451119 GGAGAGATGAAATTGATGTCAGG - Intergenic
992836332 5:80645103-80645125 CTATAGATAAAACTGGTTTCAGG - Intronic
992911843 5:81402523-81402545 GTAGAGATGAAACTGGTGCCTGG + Intergenic
995076410 5:107990016-107990038 GCAGATCTGAAACTGGATTCTGG + Intronic
995475730 5:112546413-112546435 GCACAGATGGAACTGGCTTCTGG + Intergenic
996652332 5:125894631-125894653 CCTTAGATTAAACTGGTTTCAGG - Intergenic
997036552 5:130199391-130199413 GCAGAGATGAAGCCATTTTCTGG - Intergenic
1000975522 5:167760222-167760244 GAAGAGAAGAAACTGGTTCTAGG - Intronic
1001103945 5:168836841-168836863 TCAGAGATGAAACTAGCTTTTGG + Intronic
1001264557 5:170264039-170264061 TACTAGATGAAACTGGTTTCAGG - Intronic
1002784021 6:387667-387689 GCAGAGAAGAACCCGCTTTCAGG - Intergenic
1003055714 6:2818201-2818223 GCTTAGATGAGCCTGGTTTCAGG + Intergenic
1003073465 6:2962474-2962496 ACAGAGAGGAAACTGGTATCAGG - Intronic
1003457050 6:6292852-6292874 GCAGAGCTGAAAGTGGGTGCTGG - Intronic
1003840458 6:10113811-10113833 GCAGAGCTGAAACTGTTCTCAGG - Intronic
1007135817 6:39521032-39521054 ACAAAGATGAAAATGGTTTCTGG - Intronic
1008363737 6:50651051-50651073 GCAGACAAGAAACTGTGTTCAGG - Intergenic
1010451905 6:76013084-76013106 GCAGAGAAGAAATGGTTTTCTGG + Intronic
1012125373 6:95421590-95421612 GCAGCTTTGAAACTGGTTACTGG - Intergenic
1012772130 6:103451716-103451738 GCAAAGAGGAAACAGATTTCTGG + Intergenic
1013751322 6:113409838-113409860 GCAGAGATGAAAGAAGTTTCAGG + Intergenic
1014593751 6:123306575-123306597 CTATAGATAAAACTGGTTTCAGG - Intronic
1015118176 6:129672058-129672080 GGTGATATGAGACTGGTTTCTGG - Intronic
1015360828 6:132337113-132337135 GTAGAGATGCAACTGGTTTCAGG - Intronic
1017029014 6:150204721-150204743 GCAGAGATGAAACTGAAACCTGG + Intronic
1017110714 6:150929533-150929555 GCTGTGATGATACTGTTTTCAGG + Intronic
1018449532 6:163894256-163894278 GCAGAGATGAAGCTGGTCAAAGG + Intergenic
1019046339 6:169150774-169150796 TCAGAGATTAAACTGTTTTAAGG + Intergenic
1019064910 6:169288558-169288580 GCAGAGAGGAAGCTGGAGTCTGG + Intergenic
1020734318 7:11927804-11927826 GCAGACCTGAAACTTATTTCTGG - Intergenic
1020835243 7:13141375-13141397 GAAGAGATGCAACTGGCTTCAGG - Intergenic
1021909359 7:25368790-25368812 GCAGAGATCAAACTATTCTCAGG + Intergenic
1023660687 7:42468410-42468432 GCATAGTTGAAACTTGTTTAGGG + Intergenic
1023747784 7:43338014-43338036 AGAGAGCTAAAACTGGTTTCAGG + Intronic
1024056545 7:45663168-45663190 GCAGAGAAGAAAGTGGTAACAGG - Intronic
1029248828 7:99221785-99221807 GCAGAGATGAAACTGCGACCTGG - Intergenic
1029818086 7:103117334-103117356 GGAAAGATGAAAATGGTTTTTGG + Intronic
1030553522 7:110994582-110994604 CCAAAAAGGAAACTGGTTTCTGG + Intronic
1031534878 7:122921051-122921073 GCAGAGATGGATCTGTTCTCAGG - Intergenic
1031731436 7:125306661-125306683 GCGGAGGTGGAAATGGTTTCAGG + Intergenic
1031769066 7:125820250-125820272 ACAGAGATTATACTTGTTTCAGG + Intergenic
1032483013 7:132261933-132261955 GCAGAGCTGAGATTGGTTTTGGG - Intronic
1033826703 7:145199864-145199886 GAGGGGATGAAGCTGGTTTCTGG - Intergenic
1034901128 7:154908580-154908602 GCAGCCATGAAGCTGGTTCCGGG - Intergenic
1035208218 7:157308760-157308782 ACCGAGATGAAAGTGATTTCTGG - Intergenic
1041302047 8:56421755-56421777 GCAGAGTCAAAACTGTTTTCAGG - Intergenic
1043548930 8:81346647-81346669 CGTGAGATAAAACTGGTTTCAGG + Intergenic
1043678714 8:82995148-82995170 CCATGGATAAAACTGGTTTCAGG + Intergenic
1045312731 8:101017293-101017315 GCAGGGAAGAAACGGGTCTCTGG + Intergenic
1046912405 8:119643574-119643596 GCAGAGATTATTCTGGTGTCGGG - Intronic
1048081412 8:131132097-131132119 GCAGAGATCAAACTTCTCTCAGG - Intergenic
1048273406 8:133047325-133047347 GCACAGAGGAAACTGATATCGGG + Intronic
1048883681 8:138891331-138891353 CCAGTGATGAACCTGGGTTCAGG + Intronic
1049039821 8:140104130-140104152 GCAGGGATGAAACTGTCTCCTGG + Intronic
1049307498 8:141912692-141912714 GAAGACATGAAACTGTTTCCAGG + Intergenic
1049814016 8:144589698-144589720 GCAGAGATGGACCTAGCTTCAGG - Intronic
1050381476 9:5035179-5035201 GCAGAGATTCAACTTCTTTCTGG - Intronic
1051769522 9:20561736-20561758 GCAGAGATCAAACAGATTTGTGG - Intronic
1052010525 9:23403094-23403116 GCAGTGATGAAACTTGTTGGTGG - Intergenic
1052772293 9:32700669-32700691 CCAAAGATAAAGCTGGTTTCAGG + Intergenic
1053024303 9:34717677-34717699 GGAGAGATGAACCTGGTCTGAGG + Intergenic
1053466872 9:38315222-38315244 ACTGAGCTGAAACTGGATTCCGG + Intergenic
1055908180 9:81317493-81317515 GCAGGGATGACTCTGCTTTCAGG + Intergenic
1056334143 9:85549452-85549474 GCATAAGTGAAACTGGTTGCTGG + Intronic
1056401181 9:86228906-86228928 GCAGAGCTCATACTGGTTCCAGG - Intronic
1057591542 9:96377339-96377361 CTAGAGATAAAACTGGTTTCAGG - Intronic
1057605963 9:96497809-96497831 TCAGAGAAGAAACGGGTTTAGGG + Intronic
1058852309 9:109024709-109024731 GCAAAGATGACACTGCCTTCTGG + Intronic
1060280086 9:122209802-122209824 GCAGAGATGAAACTGGTTTCAGG - Intronic
1062648536 9:137563602-137563624 GCAGAGAAGAAACTGGCCTTGGG + Intronic
1190957636 X:55210971-55210993 GCAGATGGGAAACTGGTTGCCGG + Intronic
1191128290 X:56981655-56981677 GCAGACATTAAACTGGTTTCTGG + Intronic
1191289403 X:58777974-58777996 GCAGAGATGAACCTGCCTTTGGG + Intergenic
1191348328 X:59564724-59564746 GCAGAGATGAACCTGCCTTTGGG + Intergenic
1191352139 X:59615782-59615804 GCAGAGATGAACCTGCCTTTGGG + Intergenic
1191358555 X:59701334-59701356 GCAGAGATGAACCTGCCTTTGGG + Intergenic
1191365297 X:59791343-59791365 GCAGAGATGAACCTGCCTTTGGG + Intergenic
1191410197 X:60392649-60392671 GCAGAGATGAACCTGCCTTTGGG + Intergenic
1197415767 X:126170837-126170859 GCAGCTATGAACCTGGTTTGTGG + Intergenic
1198230995 X:134689390-134689412 GCAAAAATGAATTTGGTTTCTGG - Intronic
1199848398 X:151708066-151708088 GCAGGGAAGAAACTGCTTTGGGG - Intergenic