ID: 1060280889

View in Genome Browser
Species Human (GRCh38)
Location 9:122214593-122214615
Sequence GACCACGTCTTACAGCCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060280887_1060280889 9 Left 1060280887 9:122214561-122214583 CCGCTTAGTACTGGACACTTCTT 0: 1
1: 0
2: 0
3: 9
4: 140
Right 1060280889 9:122214593-122214615 GACCACGTCTTACAGCCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060280889 Original CRISPR GACCACGTCTTACAGCCCTA AGG Intronic