ID: 1060281383

View in Genome Browser
Species Human (GRCh38)
Location 9:122218109-122218131
Sequence GCCAGACTACAAAACCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060281383_1060281387 11 Left 1060281383 9:122218109-122218131 CCCTTCTGGTTTTGTAGTCTGGC 0: 1
1: 0
2: 1
3: 15
4: 188
Right 1060281387 9:122218143-122218165 AGCTGCCTCCAACACCAGACTGG No data
1060281383_1060281390 24 Left 1060281383 9:122218109-122218131 CCCTTCTGGTTTTGTAGTCTGGC 0: 1
1: 0
2: 1
3: 15
4: 188
Right 1060281390 9:122218156-122218178 ACCAGACTGGAAGCCCCTCCAGG No data
1060281383_1060281392 27 Left 1060281383 9:122218109-122218131 CCCTTCTGGTTTTGTAGTCTGGC 0: 1
1: 0
2: 1
3: 15
4: 188
Right 1060281392 9:122218159-122218181 AGACTGGAAGCCCCTCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060281383 Original CRISPR GCCAGACTACAAAACCAGAA GGG (reversed) Intronic
901278590 1:8013263-8013285 GCCAGACTCAAAAACAAAAATGG - Exonic
903440110 1:23381469-23381491 GCAGAACTACAAAACCAGAAAGG + Exonic
906157048 1:43619942-43619964 GCCAGCCTAGAAGACCAGAGAGG + Intronic
907236340 1:53052461-53052483 TCCAAACTATAATACCAGAAGGG - Intergenic
910056572 1:83039762-83039784 GCCAGGATTCAAAACCAGCATGG + Intergenic
910350650 1:86293885-86293907 GCCAGCCTAACAAACCTGAAAGG - Intergenic
910475138 1:87598013-87598035 GCCAGAATACAAAACAAGCATGG - Intergenic
911177166 1:94828409-94828431 GCCATGTTACCAAACCAGAAAGG - Intronic
913442343 1:118911103-118911125 GCCTGACTTCAAAGCCTGAATGG - Intronic
913661053 1:121006933-121006955 GCCTGACTCTGAAACCAGAAGGG + Intergenic
914012418 1:143790106-143790128 GCCTGACTCTGAAACCAGAAGGG + Intergenic
914165414 1:145171077-145171099 GCCTGACTCTGAAACCAGAAGGG - Intergenic
914651047 1:149698716-149698738 GCCTGACTCTGAAACCAGAAGGG + Intergenic
914826016 1:151138436-151138458 GCCAGACTCCAAGACCCTAAAGG - Intronic
916688783 1:167171517-167171539 CCCAGAGTCCAAAAGCAGAAGGG + Intergenic
917141561 1:171841112-171841134 GCCAGACTACACTTCCCGAAAGG - Intergenic
918151876 1:181803936-181803958 GCAAAACTACAAAAACAGAAGGG - Intronic
918841539 1:189546921-189546943 CCCAGAATACAAAAACAGTATGG + Intergenic
919689397 1:200515612-200515634 TCCAAACTACACAACCATAATGG + Intergenic
920160225 1:203991816-203991838 GCCACACTTGAAAACAAGAAAGG - Intergenic
920696725 1:208186473-208186495 GAGAGAATACAAAACAAGAAAGG - Intronic
1068780518 10:60914715-60914737 GCCTTAATACAAAACTAGAAGGG - Intronic
1069212681 10:65780610-65780632 GGTACACTACAAAATCAGAACGG - Intergenic
1070060402 10:72977212-72977234 TCCTGATAACAAAACCAGAAAGG - Intergenic
1070429283 10:76319936-76319958 GGCAGACTTCGAAACAAGAAGGG - Intronic
1070598370 10:77848626-77848648 GACAGACAACAAAACAAGCAAGG + Intronic
1070994670 10:80765957-80765979 GCTAGACAAAAAAACCAGCAAGG - Intergenic
1071265603 10:83962073-83962095 GCCAGACACCAGAGCCAGAAGGG + Intergenic
1072191248 10:93078269-93078291 GCCAGACTCTCAATCCAGAAAGG + Intergenic
1072285355 10:93909144-93909166 GCCAGACCACAAAACTAGCTAGG - Intronic
1073324434 10:102634239-102634261 TCCAGGATAGAAAACCAGAAGGG - Intergenic
1073715560 10:106102687-106102709 GCCAAACCACAAAATCAGGAGGG - Intergenic
1074673500 10:115822533-115822555 GCCAGACTAATAAAGAAGAAAGG + Intronic
1074963802 10:118471302-118471324 GTCAGACCACAGAGCCAGAAAGG + Intergenic
1075887660 10:125915512-125915534 GCTAGACTAGAAAACCTTAAAGG + Intronic
1076597062 10:131630399-131630421 GCCAGACCACAAAGCCAGGATGG + Intergenic
1077929970 11:6720887-6720909 GTCAGACAACAAACCCAGACAGG - Intergenic
1080037840 11:27727902-27727924 GCCAGAGTTCAAGACCAGACTGG - Intergenic
1083280830 11:61626532-61626554 TCCTCACCACAAAACCAGAACGG + Intergenic
1084531338 11:69729608-69729630 CCCAGAGTACAAAAGCACAAAGG + Intergenic
1086454356 11:86946753-86946775 GACATAATACAAACCCAGAAGGG + Exonic
1086950748 11:92888035-92888057 CCCAGAGTACAAAATGAGAAAGG + Intronic
1087556752 11:99731052-99731074 GAAAGATTACAAAACTAGAAGGG + Intronic
1091868854 12:3869803-3869825 ACCAGACTGCAAACCCATAAAGG + Intronic
1092953640 12:13530131-13530153 CCCAGACAAGAAAGCCAGAAGGG + Intergenic
1092994820 12:13939906-13939928 CACAGAATACAAAACTAGAAAGG + Intronic
1093691186 12:22111138-22111160 GCCAGACGGCAGAACCAGAAAGG - Intronic
1098574207 12:72022676-72022698 GTCACACCACAAATCCAGAAAGG - Intronic
1099372620 12:81855851-81855873 GTCAGAATACAATACCAAAATGG + Intergenic
1100544466 12:95588190-95588212 GCAAGACAATAAAACCAGAAGGG - Intergenic
1101739641 12:107491008-107491030 GCCAGACTCCAAAGCCATATGGG + Intronic
1102832886 12:116023083-116023105 GCCAGAATTCAAAACCAGCCTGG + Intronic
1105284519 13:18993488-18993510 GCCAGGCCAGAGAACCAGAAAGG + Intergenic
1108536529 13:51386426-51386448 GCCAGACTAAAAAACTATGATGG + Intronic
1109438901 13:62343551-62343573 GCCAGGCTAACAGACCAGAATGG + Intergenic
1111107345 13:83664195-83664217 GCAGGACTACGAAACCAGAATGG - Intergenic
1116103537 14:40470723-40470745 CCCTGACAACAAAACCTGAAAGG + Intergenic
1116539861 14:46088303-46088325 GACAGACATCAAAACCAGTAAGG - Intergenic
1118166997 14:63346641-63346663 TCCAGAATACACAACCAGCAAGG + Intergenic
1118982338 14:70726950-70726972 GCCACACAGCAAAAGCAGAATGG + Intronic
1119904897 14:78292840-78292862 GCCAAACTCCAAAACCAGCCAGG + Intronic
1120749752 14:88186622-88186644 GCCAGGATAGAAAACCAGAAAGG - Intronic
1202870483 14_GL000225v1_random:158557-158579 GCTAGACTAGAAAACCTTAAAGG - Intergenic
1124959412 15:34383440-34383462 TCCAGACTCAAAAACCAGATGGG - Exonic
1124976038 15:34529661-34529683 TCCAGACTCAAAAACCAGATGGG - Exonic
1130621555 15:85468196-85468218 GCCAGACTAGAAAAACAGACAGG - Intronic
1132471755 16:108015-108037 GTCAGACTACATGACCACAAAGG + Intronic
1133679783 16:8110116-8110138 TCCAGACTTCAAAACGACAATGG + Intergenic
1134239517 16:12495109-12495131 GCCAGAGGAGAAAACCAGGAAGG - Intronic
1138839165 16:60477268-60477290 GCCAGGATTCAAAACCAGATTGG + Intergenic
1141611486 16:85183550-85183572 GCCAGATCACCAAATCAGAAGGG - Intronic
1142108763 16:88319896-88319918 TCCAGTCTCCAAAGCCAGAATGG + Intergenic
1142987800 17:3707466-3707488 GCCAGACTAAGAAATCAAAAAGG + Intergenic
1145790652 17:27624677-27624699 ATTAGACTCCAAAACCAGAAAGG + Exonic
1146932670 17:36788749-36788771 GCCTGCCTATAAAACCAGCATGG + Intergenic
1147191114 17:38738709-38738731 CCCAGACTAGGAACCCAGAAGGG + Intronic
1148289257 17:46428981-46429003 ACAAAACTACAAAAGCAGAAAGG - Intergenic
1148311426 17:46646553-46646575 ACAAAACTACAAAAGCAGAAAGG - Intronic
1148888622 17:50791663-50791685 CCCAGACAAGAAAACCAGATGGG + Intergenic
1150539281 17:66079764-66079786 ACAAGGCTACATAACCAGAACGG + Intronic
1151332601 17:73419658-73419680 GCCAGAGTTCAAAACCAGCCTGG + Intronic
1152681245 17:81669353-81669375 GCCAGAGTTCGAAACCAGACTGG - Intronic
1156804616 18:41162829-41162851 GCAAGAAAACAAAAACAGAACGG - Intergenic
1157909821 18:51605402-51605424 GTCAGAATTCAAAACCAGATGGG - Intergenic
1158674121 18:59502866-59502888 GAGAGACTGCAAAACTAGAAGGG - Intronic
1158933269 18:62341695-62341717 GCCAGACTGCACAAACACAAAGG - Intronic
1159221569 18:65471277-65471299 GCAAGAAGAGAAAACCAGAAGGG + Intergenic
1159646492 18:70924206-70924228 GCTAGACTAAAAAAGAAGAAAGG + Intergenic
1160156206 18:76435868-76435890 TCCAGAGAACAAAACCAGAGTGG - Intronic
1160208929 18:76859969-76859991 CCCAGACTCCACAACCAGATGGG - Intronic
1161958686 19:7510511-7510533 ACCAGACTACTAGAACAGAAAGG + Intronic
1162239296 19:9335922-9335944 GCAGCACTCCAAAACCAGAAGGG + Intronic
1165605076 19:37095378-37095400 ACCAGACAACAATACCAGATTGG - Intronic
926730381 2:16031577-16031599 ACCAGACTACGAACCCAGCACGG - Intergenic
927326697 2:21813180-21813202 GACAGATTACAGACCCAGAAAGG - Intergenic
927505060 2:23607451-23607473 TCAAGACTAAAAAACCAAAATGG - Intronic
930238193 2:48908133-48908155 TCCACACTAGAACACCAGAAGGG + Intergenic
930618919 2:53624375-53624397 GCCAGTGTACAAAACCTGCATGG - Intronic
932749889 2:74364789-74364811 GTCAGATTACAGAGCCAGAAAGG + Intronic
935650857 2:105380905-105380927 GGAAAAATACAAAACCAGAAAGG - Intronic
935742245 2:106159929-106159951 TGCAGACTACAAAATCAGATGGG + Intronic
938198218 2:129351582-129351604 TCCAGACTATAAATTCAGAAAGG - Intergenic
939640548 2:144635545-144635567 GCCAGACTAATAAAGAAGAAAGG - Intergenic
943762782 2:191628236-191628258 GCCTGATTACAAATCCCGAAGGG + Intergenic
946101540 2:217329233-217329255 GTCATCGTACAAAACCAGAAAGG - Intronic
948131453 2:235603454-235603476 GCCAGACACCAAGATCAGAATGG + Intronic
1169702316 20:8460816-8460838 CCCAGCCTACAGAATCAGAATGG - Intronic
1171220838 20:23395913-23395935 GCCTGACTACAAAATTAGAAAGG + Intronic
1171484562 20:25477592-25477614 GCAAGACCACAGCACCAGAAGGG + Intronic
1177933905 21:27318442-27318464 GCCAGTTTACAGACCCAGAACGG - Intergenic
1179580338 21:42339303-42339325 GCCTCACCACAAACCCAGAAGGG + Intergenic
1181863803 22:25839875-25839897 GCCATCCTACAGAACCAGGAGGG - Intronic
949148546 3:735088-735110 GCCATACTACATATCCAGCATGG + Intergenic
950619398 3:14191671-14191693 GCCAGACTAATAAAGAAGAAAGG - Intronic
950871927 3:16237169-16237191 GCCAGACTTCAAAACACAAATGG + Intergenic
953433700 3:42861115-42861137 GCCAGACTGATAAACAAGAAAGG + Intronic
953567000 3:44041223-44041245 TCCAGAGTAGAAAACCAAAATGG - Intergenic
959174145 3:102884173-102884195 GCCAGAACACAAAGACAGAATGG - Intergenic
959340265 3:105120639-105120661 GCCAGCCTCCATAACAAGAAAGG + Intergenic
959613865 3:108325545-108325567 GCCAAACTACAAAACCAAGATGG - Intronic
960497150 3:118388180-118388202 CCTATAGTACAAAACCAGAATGG + Intergenic
960828179 3:121814516-121814538 GCCAGACTAATAAAAAAGAAAGG + Intronic
962455029 3:135557176-135557198 GCCAGAAAACAATACCAAAAAGG + Intergenic
964431782 3:156614864-156614886 ACCAGACTTGAATACCAGAAAGG - Intergenic
969224480 4:5785999-5786021 GCCTGGCTGCAAAACCACAATGG - Intronic
970429972 4:15980088-15980110 GGCAGACTACAGAGCCAAAATGG + Intronic
970579693 4:17463995-17464017 GCCAGGCAACAAACCCAGATGGG + Intronic
972466730 4:39364694-39364716 GCCAGGCACCAGAACCAGAACGG + Intronic
972721956 4:41708710-41708732 GCCAGATTACAAGGCAAGAAAGG + Intergenic
972928699 4:44044251-44044273 GCCAGACTAATAAAGAAGAAAGG + Intergenic
974473071 4:62343761-62343783 GCCAGAAAACAAAAGAAGAAAGG - Intergenic
976735723 4:88307023-88307045 ATCAGACCACCAAACCAGAATGG - Intergenic
976783940 4:88795623-88795645 GCCAGACTACATAGATAGAATGG - Intronic
977785741 4:101032637-101032659 GCCTGATTACAAAATCAAAATGG - Intronic
978108571 4:104933707-104933729 GCCAGACTAGTAAAGAAGAAAGG + Intergenic
979430160 4:120620016-120620038 GCTAAATTACAAAAACAGAAAGG + Intergenic
980223014 4:129944838-129944860 GCCAGACTAATAAAGAAGAAAGG - Intergenic
982733098 4:158977482-158977504 GCCAGACTAATAAAGAAGAAAGG - Intronic
983014706 4:162599048-162599070 GCGAGACTACAAATGGAGAAAGG + Intergenic
983796147 4:171866517-171866539 GTATGACTAGAAAACCAGAAAGG + Intronic
984220930 4:176973560-176973582 ACCACATTACAAAAGCAGAAAGG + Intergenic
984344855 4:178509882-178509904 GCCAGACAACAAATTTAGAAAGG - Intergenic
984813008 4:183811304-183811326 TCCAGAATTCAAAAGCAGAAAGG + Intergenic
986443207 5:7798989-7799011 GCCACACTCCAAAAACTGAAAGG + Intronic
987687885 5:21228529-21228551 GCAAGACTAATAAACAAGAAAGG + Intergenic
988324032 5:29738302-29738324 GCCAGAGAACACGACCAGAAAGG + Intergenic
988867417 5:35350885-35350907 GCCAGACTACTAAAGAAGAAAGG - Intergenic
989687313 5:44105430-44105452 GCCAGACTAATAAAGAAGAAAGG - Intergenic
990250808 5:53913087-53913109 GCCGGACTTCAAGACCAGACTGG + Intronic
992868521 5:80982364-80982386 CCCTGACCACAAAGCCAGAAAGG - Intronic
993984949 5:94586292-94586314 GCCAGACTAATAAAGAAGAAAGG + Intronic
995216114 5:109596897-109596919 GCCAGGCTTCAAACCCAGACAGG + Intergenic
1000803090 5:165752759-165752781 GCTAGAAAACAAAACAAGAAAGG - Intergenic
1003494638 6:6653506-6653528 GGCAGCAAACAAAACCAGAATGG + Intronic
1003909827 6:10733172-10733194 GGGAGACTACAAAACCGCAAGGG - Intergenic
1004061221 6:12199980-12200002 CCTAGACTTCAAAATCAGAATGG - Intergenic
1005084461 6:21990776-21990798 GCCAGACTACACAATCTGAATGG + Intergenic
1005991842 6:30908082-30908104 GTCTGACTACAAATCCCGAAAGG - Intergenic
1006991441 6:38218072-38218094 ACCCAACTACACAACCAGAACGG - Intronic
1008432937 6:51441488-51441510 CCCAGACTACACTACAAGAAAGG - Intergenic
1010927634 6:81763208-81763230 GCCAGGCTGGAAAAACAGAATGG + Intergenic
1011874238 6:91937099-91937121 GCCAGACTTCAAAAGAAGCATGG - Intergenic
1015457431 6:133443095-133443117 CCCTGACCCCAAAACCAGAAAGG - Intronic
1015831918 6:137379184-137379206 AGCAGACTATAAAACCAGGAAGG - Intergenic
1019543583 7:1562171-1562193 GCCAAACTATAAAACCAGCGTGG + Intergenic
1020825186 7:13018080-13018102 GCCAGACTATAAAACCACAAAGG + Intergenic
1021385472 7:20024523-20024545 GCCAGACTAATAAAGAAGAAAGG - Intergenic
1023900206 7:44470686-44470708 CACAAACAACAAAACCAGAAGGG + Intronic
1024345409 7:48308552-48308574 GCCAGGCTACAACACTACAATGG + Intronic
1027265465 7:76492866-76492888 GCCAGGCTGCTAAAACAGAATGG - Intronic
1027266902 7:76499513-76499535 CCCAGACTCCAGGACCAGAAGGG - Intronic
1027316836 7:76990983-76991005 GCCAGGCTGCTAAAACAGAATGG - Intergenic
1027318717 7:76999381-76999403 CCCAGACTCCAGGACCAGAAGGG - Intergenic
1028635553 7:92985243-92985265 TCCAGAGTTCAAAACCAGACTGG - Intergenic
1028747134 7:94339935-94339957 GAAAGACTACAAAAATAGAAGGG + Intergenic
1028863839 7:95684746-95684768 TCCAGAGAACAAAACCAGAAGGG + Intergenic
1029264414 7:99326846-99326868 TCCAGACTTGAAGACCAGAATGG + Intronic
1033913581 7:146295391-146295413 GCCAGCCTAGAAAACTGGAAGGG - Intronic
1034011870 7:147537132-147537154 GCTAGACTAAAAGACCAGCATGG - Intronic
1037983211 8:23269851-23269873 GCCAGAAAAGAAAACCAAAAGGG + Intergenic
1038783540 8:30589836-30589858 ACCAGACACCAAAACAAGAAGGG + Intronic
1040693415 8:49967254-49967276 GACAGACTCCAAAGCCAGACAGG - Intronic
1044048165 8:87463979-87464001 GCCAGACTAATAAATAAGAAAGG - Intronic
1044377284 8:91491075-91491097 GACAAACTACAAAGCAAGAAAGG + Intergenic
1045204355 8:100022375-100022397 GACAGAGTAAAAAATCAGAAGGG + Intronic
1045967327 8:108040358-108040380 GCTAGACTTCAAAATCAGAAGGG + Intronic
1047096983 8:121636419-121636441 GGCAGACTTCAAAGCCAGAGAGG - Intronic
1047185358 8:122628154-122628176 GCCAGACTACCAAATCTGGAGGG + Intergenic
1048507951 8:135037409-135037431 TGCAGACTCCAAAAGCAGAAAGG - Intergenic
1050616781 9:7409439-7409461 GCCAGATAAAAAAACCAGTAAGG - Intergenic
1056939076 9:90939726-90939748 CCCAGTCTACAATGCCAGAATGG - Intergenic
1059513706 9:114873439-114873461 GCCAGACTAATAAAGAAGAAAGG + Intergenic
1060281383 9:122218109-122218131 GCCAGACTACAAAACCAGAAGGG - Intronic
1061947005 9:133914126-133914148 GCCAGCCTCCAAACCCAGCATGG + Intronic
1203733974 Un_GL000216v2:118025-118047 GCTAGACTAGAAAACCTTAAAGG + Intergenic
1186851464 X:13584188-13584210 GCCAGAATTCAAACCCAGGAAGG + Intronic
1187567961 X:20471091-20471113 CCCAGACCAGAAGACCAGAAGGG - Intergenic
1187571260 X:20505522-20505544 CCCAAACAACAAAAACAGAAGGG + Intergenic
1188352249 X:29146093-29146115 GCCAGAATACAAAATTACAAGGG + Intronic
1197430504 X:126357519-126357541 GCTACACTACAAAAACAGCATGG + Intergenic
1197586125 X:128350596-128350618 GCCAGACTAATAAAGGAGAAAGG - Intergenic
1198037575 X:132816866-132816888 GGCAGACAACAGAACCAGCATGG + Intronic
1198743179 X:139862736-139862758 GCCAGAGTACAAATCCAAATTGG + Intronic
1199567124 X:149227303-149227325 GCTAGACTACTAAAGAAGAAGGG - Intergenic
1202627037 Y:56870384-56870406 GCTAGACTAGAAAACCTTAAAGG - Intergenic