ID: 1060281384

View in Genome Browser
Species Human (GRCh38)
Location 9:122218110-122218132
Sequence TGCCAGACTACAAAACCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060281384_1060281392 26 Left 1060281384 9:122218110-122218132 CCTTCTGGTTTTGTAGTCTGGCA 0: 1
1: 0
2: 0
3: 9
4: 167
Right 1060281392 9:122218159-122218181 AGACTGGAAGCCCCTCCAGGAGG No data
1060281384_1060281390 23 Left 1060281384 9:122218110-122218132 CCTTCTGGTTTTGTAGTCTGGCA 0: 1
1: 0
2: 0
3: 9
4: 167
Right 1060281390 9:122218156-122218178 ACCAGACTGGAAGCCCCTCCAGG No data
1060281384_1060281387 10 Left 1060281384 9:122218110-122218132 CCTTCTGGTTTTGTAGTCTGGCA 0: 1
1: 0
2: 0
3: 9
4: 167
Right 1060281387 9:122218143-122218165 AGCTGCCTCCAACACCAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060281384 Original CRISPR TGCCAGACTACAAAACCAGA AGG (reversed) Intronic
902084836 1:13850945-13850967 TGCCTGCCTGCAAAACCATAGGG + Intergenic
903642740 1:24871026-24871048 TGCCAGTCCACAAAGCCACAGGG + Intergenic
905299544 1:36977089-36977111 TACCTGACTCCAACACCAGAGGG - Intronic
906543922 1:46608330-46608352 TGCCAGAATGGAAAGCCAGAGGG - Exonic
907892588 1:58649874-58649896 TGTCTCTCTACAAAACCAGAAGG + Intergenic
909116721 1:71546703-71546725 AGCCAGAGTTCAAATCCAGAGGG + Intronic
913661052 1:121006932-121006954 TGCCTGACTCTGAAACCAGAAGG + Intergenic
914012417 1:143790105-143790127 TGCCTGACTCTGAAACCAGAAGG + Intergenic
914165415 1:145171078-145171100 TGCCTGACTCTGAAACCAGAAGG - Intergenic
914651046 1:149698715-149698737 TGCCTGACTCTGAAACCAGAAGG + Intergenic
916688781 1:167171516-167171538 TCCCAGAGTCCAAAAGCAGAAGG + Intergenic
918151877 1:181803937-181803959 AGCAAAACTACAAAAACAGAAGG - Intronic
918291107 1:183108892-183108914 TGCCAGGCTAGAGAAGCAGATGG + Intronic
920587945 1:207186754-207186776 GGCCAGACTAGTAAACCAAAGGG - Intergenic
920656094 1:207876302-207876324 TGTCTGACTCCAAAGCCAGAGGG + Intergenic
920717332 1:208352716-208352738 TCCCAGCCTTCAAAACCAGAAGG - Intergenic
922246425 1:223802844-223802866 TGCCAAGCTACAACAACAGAGGG - Exonic
922285415 1:224166734-224166756 TGCTAGACTACAAAACTGTATGG - Intergenic
923512965 1:234668735-234668757 TGCCAGACAACCAAACCCGTTGG + Intergenic
1063026233 10:2181518-2181540 TGGCAGACTAGAAATCCTGAAGG + Intergenic
1064598569 10:16970630-16970652 TGGCAGACTAGAAAAATAGAGGG - Intronic
1065710586 10:28513312-28513334 TCCCAGCCTCCAGAACCAGAAGG + Intergenic
1068608670 10:59034239-59034261 TGCCAGACTACATCACAAGAGGG - Intergenic
1070429284 10:76319937-76319959 TGGCAGACTTCGAAACAAGAAGG - Intronic
1070552351 10:77500855-77500877 TTCCAACCTCCAAAACCAGAGGG - Intronic
1071046454 10:81385471-81385493 TCCCAGACTAAAAAAGCTGAGGG - Intergenic
1071265602 10:83962072-83962094 TGCCAGACACCAGAGCCAGAAGG + Intergenic
1073303107 10:102482920-102482942 TGCCAGACTCCAGACCCTGATGG + Intronic
1074308528 10:112301028-112301050 TCCCAGGCCACAAAACCAGGTGG - Intronic
1075190754 10:120306183-120306205 TTCCAGGCTACAATACCAGTTGG - Intergenic
1076235215 10:128858766-128858788 TGCCACACTGCAACACCAGTGGG - Intergenic
1076530015 10:131137809-131137831 TTAGAGAATACAAAACCAGAGGG + Intronic
1077831950 11:5882439-5882461 TGCCAGGCTGAAAAATCAGAGGG - Intronic
1078256333 11:9662421-9662443 TGCCAGTCAGCAAAACCACATGG - Intergenic
1078852529 11:15177834-15177856 TCCCAGACAAGAAAAACAGAGGG - Intronic
1081458533 11:43249335-43249357 TGCCAGCTTCCAAAAACAGATGG - Intergenic
1089759067 11:120709582-120709604 TCCCACATTGCAAAACCAGATGG - Intronic
1089878029 11:121744843-121744865 TGCCAAAATACAAAACTGGAGGG - Intergenic
1090246623 11:125220734-125220756 TTTCTGACTACAAAAGCAGAGGG + Intronic
1092560296 12:9605645-9605667 AGGCAGTCAACAAAACCAGAAGG - Intronic
1092645802 12:10570843-10570865 TTCCATACTACAAAACAAGGTGG - Intergenic
1092865139 12:12753847-12753869 TTCCAGAGGAAAAAACCAGAAGG + Intronic
1093730042 12:22556816-22556838 TGCCAGACTATTAAAACAGTTGG + Intergenic
1095757707 12:45787913-45787935 TGCCAGATTAGAAAAGCAAAAGG - Intronic
1100544467 12:95588191-95588213 GGCAAGACAATAAAACCAGAAGG - Intergenic
1100608004 12:96167600-96167622 TGCCACACTCCAAGACCAGCAGG + Intergenic
1101025942 12:100607128-100607150 TCCCAGACAACAAAAACTGAGGG - Intronic
1101649279 12:106660223-106660245 TGAGTGACTGCAAAACCAGATGG + Intronic
1101739640 12:107491007-107491029 TGCCAGACTCCAAAGCCATATGG + Intronic
1103221030 12:119245691-119245713 TGCCAGACTGGAAAACCTCATGG - Intergenic
1103964529 12:124630388-124630410 AGCCAGACTGCAAACCCAGGAGG + Intergenic
1106765642 13:32911045-32911067 TGCCACACCACAATACCAGGTGG - Intergenic
1114254891 14:20993264-20993286 TAACAGACTGGAAAACCAGAGGG + Intronic
1114696949 14:24634267-24634289 TGAGACACCACAAAACCAGAGGG - Exonic
1115558910 14:34565441-34565463 TCACAGACTACAAAAGCAGGTGG + Intronic
1116164216 14:41312201-41312223 TTCCAGCCTACAAAAGCAGCTGG + Intergenic
1116250758 14:42480451-42480473 TTCCAGACTACAAAGCAGGAAGG + Intergenic
1117102458 14:52364374-52364396 TGCCAGACTCAAAATCCAGAGGG + Intergenic
1118963958 14:70562085-70562107 TGCCAGCCCACAAAAGCAGCTGG + Intergenic
1119745840 14:77043346-77043368 TGCTAGACAACAAAACAAAAGGG - Intergenic
1124959413 15:34383441-34383463 GTCCAGACTCAAAAACCAGATGG - Exonic
1124976039 15:34529662-34529684 GTCCAGACTCAAAAACCAGATGG - Exonic
1129158126 15:73731606-73731628 AGCGAGACTACAAAACCACCAGG - Intergenic
1130778452 15:87009644-87009666 TGCCAGCCCACAAAAGCAGCTGG + Intronic
1142391510 16:89803978-89804000 TGCCAATCTCCAATACCAGAGGG + Intronic
1143677020 17:8441324-8441346 TCAAAGGCTACAAAACCAGAGGG + Intronic
1146476951 17:33170637-33170659 TCCCAGACTTCAAAAACAAAAGG + Intronic
1148548139 17:48532348-48532370 TCTCAGACTCCAAACCCAGATGG + Intergenic
1148888620 17:50791662-50791684 ACCCAGACAAGAAAACCAGATGG + Intergenic
1150231550 17:63554955-63554977 TGCTAGACTACAAAATGAGTTGG - Intronic
1153760976 18:8331853-8331875 AGCAAGACTTCAAAAACAGAAGG - Intronic
1155304852 18:24469069-24469091 TGCCAGACAACAAAAGGATAGGG - Intronic
1155411276 18:25547829-25547851 AGCCAGACTAAGAAACAAGAGGG + Intergenic
1156403370 18:36760592-36760614 TGCCAGACTGCAAAACCAAGGGG - Exonic
1157909822 18:51605403-51605425 AGTCAGAATTCAAAACCAGATGG - Intergenic
1159221568 18:65471276-65471298 TGCAAGAAGAGAAAACCAGAAGG + Intergenic
1160208931 18:76859970-76859992 GCCCAGACTCCACAACCAGATGG - Intronic
1161374394 19:3931844-3931866 TCCCATACTACAAAACCCCATGG + Intergenic
1165185535 19:34017712-34017734 TTTGAGACAACAAAACCAGATGG + Intergenic
1166425176 19:42671006-42671028 CGCCAGACCACTAAATCAGAAGG - Intronic
925674388 2:6344946-6344968 TGCCCATCTACAAAACAAGAAGG + Intergenic
925778931 2:7361834-7361856 TGGCAGATAAAAAAACCAGAGGG + Intergenic
927158178 2:20234127-20234149 GGCCAGAGTTCAAATCCAGACGG - Intergenic
927620966 2:24658095-24658117 TGCCTGACTACATAAACAAAAGG + Intronic
927903011 2:26835719-26835741 TGCAAAACTATAAAACTAGAAGG + Intergenic
928617783 2:33056665-33056687 AGCGAGACCACAAACCCAGAAGG - Intronic
930203574 2:48566678-48566700 TGCCAGTTTGCAAACCCAGATGG - Intronic
930238192 2:48908132-48908154 TTCCACACTAGAACACCAGAAGG + Intergenic
931009419 2:57891550-57891572 TGCCAGTCTTCCAAACCAGCTGG + Intergenic
931685554 2:64789250-64789272 TGCAACACTACAAAACAGGAAGG - Intergenic
934577086 2:95409633-95409655 TGCCAGCCAATAAAAACAGAAGG - Intronic
935742244 2:106159928-106159950 TTGCAGACTACAAAATCAGATGG + Intronic
936386934 2:112039214-112039236 TGGCAGACTAGAAAACTCGAAGG - Intergenic
939667150 2:144965814-144965836 TGCCAGCCCACAAAAGCAGCTGG + Intergenic
940157787 2:150677554-150677576 TGCCGGATTACAATAACAGAGGG + Intergenic
943473580 2:188327033-188327055 TGTCAGACTTAAAAACCATATGG + Intronic
943697717 2:190954164-190954186 TGTCAGACTTCAAAACAAGGGGG - Intronic
943721967 2:191214158-191214180 TGCCAGAGTACAATAACAAAGGG + Intergenic
943762781 2:191628235-191628257 TGCCTGATTACAAATCCCGAAGG + Intergenic
944185591 2:196944796-196944818 TGACAGAATACAGAACGAGAGGG + Intergenic
944920751 2:204410730-204410752 CTCCAGACTACAGATCCAGAGGG + Intergenic
947729122 2:232418507-232418529 TGCCAGACTCCCCAAACAGATGG + Intergenic
947948352 2:234125914-234125936 TGCCAGACTCTAAAAAGAGAGGG - Intergenic
1171150700 20:22824326-22824348 TGCCAGGCTACACAGCCACAGGG - Intergenic
1171252360 20:23658434-23658456 TGCCAGAATACAACACAAAATGG + Intergenic
1175207602 20:57323304-57323326 TCACAGACTACAGACCCAGATGG - Intergenic
1179530328 21:42014045-42014067 TGCCAGACTACATGGCTAGAGGG - Intergenic
1181863804 22:25839876-25839898 TGCCATCCTACAGAACCAGGAGG - Intronic
1183759042 22:39799084-39799106 TGCCTGAGTATAAAACCAGAGGG - Intronic
950311557 3:11962953-11962975 AGCGAGAATACAAAAGCAGAAGG + Intergenic
952989367 3:38818244-38818266 AACCCAACTACAAAACCAGAAGG - Intergenic
955955717 3:64287504-64287526 TTCCAGAATATAAAACCACATGG + Intronic
956828342 3:73020109-73020131 TGCCAGCCTCCAAAACCATGAGG - Intronic
957693028 3:83596547-83596569 TGCTAGCCTACAAAAGCAGCTGG + Intergenic
958341938 3:92663001-92663023 TTCCAGACTTCACAAACAGAGGG - Intergenic
958376863 3:93234916-93234938 TTCCAGACTTCACAAACAGAGGG - Intergenic
958378245 3:93257380-93257402 TTCCAGACTTCACAAACAGAGGG - Intergenic
959532761 3:107452184-107452206 TGCCAGACAACCAAACCTGCTGG + Intergenic
959742521 3:109737194-109737216 TGCCAGCCCATAAAACCAGCTGG - Intergenic
959789871 3:110346731-110346753 TGCAAGACACCAAAACCACAAGG + Intergenic
962470203 3:135700562-135700584 TGCAAGATTACATAAACAGATGG + Intergenic
964783393 3:160365984-160366006 TGCCTGACTGCTAAACTAGAGGG - Intronic
964923472 3:161926756-161926778 TGCCAGCCTGCAAAAGCAGCTGG + Intergenic
970579692 4:17463994-17464016 AGCCAGGCAACAAACCCAGATGG + Intronic
970948741 4:21727430-21727452 TGCCAGCCTCCAGAACCATAAGG + Intronic
972468472 4:39381672-39381694 TCCCAGACAACAAAAACTGAAGG - Intergenic
972950295 4:44313353-44313375 TGACAGACCACAAGACCATATGG - Intronic
975123161 4:70751342-70751364 TGCCAGACTGCCAAAGCAGCTGG + Intronic
977096090 4:92746705-92746727 TGACAGACTAGAAATACAGAAGG - Intronic
977338656 4:95729832-95729854 TGCTAGCCTACAAAAGCAGTTGG - Intergenic
978737390 4:112099387-112099409 AGCTGGACTACAAAAGCAGAAGG + Intergenic
981663331 4:147193234-147193256 ATCCATGCTACAAAACCAGAAGG - Intergenic
989335796 5:40315412-40315434 TTCCAGACTAGAGATCCAGAGGG + Intergenic
991119203 5:62992032-62992054 TGCCAGAATATAGAAGCAGAGGG - Intergenic
991514144 5:67415455-67415477 TGACAGACTAAAAAAAAAGAAGG - Intergenic
993828531 5:92723829-92723851 TGGCAGACTACAAAGATAGAGGG + Intergenic
994286814 5:97979443-97979465 AGCCAGACATCAAAACCAGCAGG - Intergenic
997689961 5:135821718-135821740 TGCCAGGCAAGAAAGCCAGATGG - Intergenic
998807273 5:145930999-145931021 TGTTAGACTCCAAAACCATAGGG + Intergenic
999297083 5:150466380-150466402 TCCCAGGCTACAGAGCCAGAGGG - Intergenic
1000280463 5:159777362-159777384 TTCCAGACGACAAAAACAGTGGG - Intergenic
1005971781 6:30767425-30767447 GGACAGAGTACAAAACCATATGG + Intergenic
1006693396 6:35909739-35909761 TGCCACACTTCAAAACCATCAGG - Intronic
1010554776 6:77265603-77265625 AGCCAGTCTCCATAACCAGATGG - Intergenic
1011451095 6:87492990-87493012 TATCAGACCACAAAACCAGTAGG - Intronic
1014286355 6:119503388-119503410 AGCGAGACTAGAAAGCCAGAGGG - Intergenic
1014651428 6:124043632-124043654 TGTCAGACCAAACAACCAGATGG + Intronic
1019441646 7:1050453-1050475 TGCCAGACTCCCAAGCCACAGGG - Intronic
1020031122 7:4933495-4933517 TGCCCAACAACAAAGCCAGATGG - Intronic
1025763405 7:64416550-64416572 TGCCTGTCTACTAATCCAGATGG - Intergenic
1027266904 7:76499514-76499536 TCCCAGACTCCAGGACCAGAAGG - Intronic
1027318719 7:76999382-76999404 TCCCAGACTCCAGGACCAGAAGG - Intergenic
1028380786 7:90196246-90196268 TGCAAGATAACAAAAGCAGAGGG - Intronic
1028863838 7:95684745-95684767 TTCCAGAGAACAAAACCAGAAGG + Intergenic
1029027182 7:97429212-97429234 TGCAAGACCACAAACCCACATGG + Intergenic
1031368925 7:120939746-120939768 TTACAAACTACAAAAACAGAGGG + Intergenic
1033802331 7:144915947-144915969 TGCTTGACTGCAAAACCAGAAGG + Intergenic
1036717207 8:11136756-11136778 TCCCAGACCTCAGAACCAGAAGG + Intronic
1037303232 8:17476424-17476446 TCCCAGACAACAAAAACTGATGG - Intergenic
1041883477 8:62780051-62780073 TGCTACCCTACAAAACAAGAGGG + Intronic
1044541743 8:93416196-93416218 TGAGAGAATACAAAACAAGAAGG + Intergenic
1045967326 8:108040357-108040379 GGCTAGACTTCAAAATCAGAAGG + Intronic
1047185357 8:122628153-122628175 TGCCAGACTACCAAATCTGGAGG + Intergenic
1048784406 8:138035137-138035159 CTCCAGACTATAAAACCTGAGGG - Intergenic
1050296606 9:4211481-4211503 TGCCAGCACACAACACCAGACGG + Intronic
1050953432 9:11626272-11626294 TGCCACACTTCAAAACCACCAGG - Intergenic
1054907202 9:70421455-70421477 TGCCAGACTCCATAAGGAGAGGG - Intergenic
1058011408 9:99981561-99981583 TGCCAGGGAATAAAACCAGAGGG - Exonic
1059810950 9:117855017-117855039 TCAGAGACTGCAAAACCAGAAGG - Intergenic
1060281384 9:122218110-122218132 TGCCAGACTACAAAACCAGAAGG - Intronic
1187571258 X:20505521-20505543 TCCCAAACAACAAAAACAGAAGG + Intergenic
1187767236 X:22655755-22655777 TGCCAGACTGGAGACCCAGAAGG + Intergenic
1191036159 X:56028362-56028384 TACCAGAACATAAAACCAGAAGG - Intergenic
1191914598 X:66188041-66188063 TGTCAGACTTGAAGACCAGAGGG + Intronic
1200297317 X:154933755-154933777 TGCCATACTAAAACACAAGAAGG + Intronic
1201544948 Y:15151537-15151559 TGCTTGAGTTCAAAACCAGATGG + Intergenic
1201554977 Y:15258099-15258121 TGCCAGAACCTAAAACCAGAAGG + Intergenic