ID: 1060281392

View in Genome Browser
Species Human (GRCh38)
Location 9:122218159-122218181
Sequence AGACTGGAAGCCCCTCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060281384_1060281392 26 Left 1060281384 9:122218110-122218132 CCTTCTGGTTTTGTAGTCTGGCA 0: 1
1: 0
2: 0
3: 9
4: 167
Right 1060281392 9:122218159-122218181 AGACTGGAAGCCCCTCCAGGAGG No data
1060281383_1060281392 27 Left 1060281383 9:122218109-122218131 CCCTTCTGGTTTTGTAGTCTGGC 0: 1
1: 0
2: 1
3: 15
4: 188
Right 1060281392 9:122218159-122218181 AGACTGGAAGCCCCTCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060281392 Original CRISPR AGACTGGAAGCCCCTCCAGG AGG Intronic
No off target data available for this crispr