ID: 1060281717

View in Genome Browser
Species Human (GRCh38)
Location 9:122219655-122219677
Sequence TTCGTCGCAACCCGGTGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060281712_1060281717 0 Left 1060281712 9:122219632-122219654 CCTCAACGTTGCGCCACCTCGGC 0: 1
1: 0
2: 1
3: 1
4: 26
Right 1060281717 9:122219655-122219677 TTCGTCGCAACCCGGTGAGGTGG No data
1060281709_1060281717 13 Left 1060281709 9:122219619-122219641 CCGGGGTCCTGGGCCTCAACGTT 0: 1
1: 0
2: 0
3: 17
4: 125
Right 1060281717 9:122219655-122219677 TTCGTCGCAACCCGGTGAGGTGG No data
1060281706_1060281717 25 Left 1060281706 9:122219607-122219629 CCTTACTACGGGCCGGGGTCCTG 0: 1
1: 0
2: 0
3: 10
4: 34
Right 1060281717 9:122219655-122219677 TTCGTCGCAACCCGGTGAGGTGG No data
1060281710_1060281717 6 Left 1060281710 9:122219626-122219648 CCTGGGCCTCAACGTTGCGCCAC 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1060281717 9:122219655-122219677 TTCGTCGCAACCCGGTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060281717 Original CRISPR TTCGTCGCAACCCGGTGAGG TGG Intronic
No off target data available for this crispr