ID: 1060282333

View in Genome Browser
Species Human (GRCh38)
Location 9:122222861-122222883
Sequence CTCCCAACGGGGCAAGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060282333_1060282342 -5 Left 1060282333 9:122222861-122222883 CCTCCCCCTTGCCCCGTTGGGAG 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1060282342 9:122222879-122222901 GGGAGCTCTTGGCCTCTCTTTGG No data
1060282333_1060282343 -4 Left 1060282333 9:122222861-122222883 CCTCCCCCTTGCCCCGTTGGGAG 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1060282343 9:122222880-122222902 GGAGCTCTTGGCCTCTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060282333 Original CRISPR CTCCCAACGGGGCAAGGGGG AGG (reversed) Intronic
904260386 1:29284410-29284432 CTCCCAGGAGGGCAAGAGGGTGG + Intronic
912411551 1:109483884-109483906 CCCGCGACGGGGCGAGGGGGAGG + Intronic
912514097 1:110207337-110207359 CTCCCAGTGGGGAAAGGGGAAGG + Intergenic
913201053 1:116495617-116495639 CTTCCAGTGGGGCACGGGGGTGG - Intergenic
913342716 1:117775326-117775348 CTGCCAGTGGGGGAAGGGGGAGG + Intergenic
915406529 1:155664090-155664112 CTCCAAACTGGGCAACAGGGTGG + Intronic
915532666 1:156512123-156512145 CTCTCAAGGGGGCGTGGGGGTGG + Intergenic
916211548 1:162363961-162363983 CTCCAATCTGGGCAAGAGGGAGG + Intronic
918511554 1:185318165-185318187 CTCCCTCCCGGGCAAGGTGGTGG - Intergenic
920286784 1:204885373-204885395 CCCCCCACAGGGCAAAGGGGAGG - Intronic
920338129 1:205258510-205258532 CTCCCAGGTGGGCAAAGGGGTGG - Intronic
924582213 1:245332330-245332352 CTCCCAAGGGGGCAGGTGAGAGG + Intronic
1062932591 10:1362950-1362972 CTCCCAACAGGGAAAGGTCGGGG + Intronic
1062988641 10:1794631-1794653 ATCCGACGGGGGCAAGGGGGTGG - Intergenic
1067411446 10:46068361-46068383 GTCCCAAAGGGGGAAGTGGGTGG + Intergenic
1083227707 11:61295115-61295137 CTCCCCACGGCGCCAGGAGGAGG - Exonic
1086929084 11:92672603-92672625 CACCCAAAGAGGCAAAGGGGTGG - Intronic
1086987468 11:93266197-93266219 CTCTCAACAGGGCAATGGGGAGG - Intergenic
1089636905 11:119820640-119820662 CTCTCAAAGAGGCAAGGGGCAGG + Intergenic
1090366647 11:126211983-126212005 CTCCTAAGGGGGCGCGGGGGCGG - Intronic
1090948107 11:131449321-131449343 CTCCCACAGGGGCATGGAGGTGG + Intronic
1093502373 12:19827634-19827656 CTCACAACGTGGCAAGCGGGGGG + Intergenic
1094606808 12:31956413-31956435 CTCACACCTGGGCAAGGGAGGGG + Intergenic
1101127391 12:101651169-101651191 CTCCCAACAGGCCAAGATGGTGG - Intronic
1105213739 13:18272738-18272760 TGTCCAACGGGGCAAGGAGGAGG - Intergenic
1106149344 13:27083437-27083459 CTGGCATGGGGGCAAGGGGGAGG - Intronic
1110235427 13:73212829-73212851 CTCCCAGCAGGGCAAGTGTGAGG + Intergenic
1112034771 13:95486788-95486810 CTCACAACGTGGCCAGGTGGAGG - Intronic
1115203221 14:30874996-30875018 CACCCAGCGGAGCAAGGGGCCGG - Intronic
1118174720 14:63426855-63426877 CTTCCATTGGGGCACGGGGGAGG + Intronic
1122208328 14:100159450-100159472 CTCCAGACGGGCCAACGGGGCGG + Intronic
1122543698 14:102510950-102510972 CTCCCACCGGGGCGAGGCAGAGG - Intergenic
1122624864 14:103079390-103079412 CTGCCCAAGTGGCAAGGGGGCGG + Intergenic
1122858673 14:104572318-104572340 CCCAGAACGGGGCAAGGGGGAGG + Intronic
1122879070 14:104681954-104681976 CTCCCAAGGCGGGAAGTGGGAGG + Intergenic
1122974289 14:105164688-105164710 CTCCCTAGGGGGCAAAGGAGAGG + Intronic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1125284077 15:38073292-38073314 ATCCCGAGGGGGCAAGGGTGGGG - Intergenic
1127065287 15:55230965-55230987 CTCCAAAAGGGGGAAGGGAGTGG - Intronic
1129770656 15:78201347-78201369 CTCCCTGGGGGGCAAGGGTGAGG - Intronic
1130027909 15:80285690-80285712 CTCCCAAGGAGGCACGGTGGAGG - Intergenic
1131395880 15:92085496-92085518 CTCCCAACTAGGCAATGGGTTGG - Intronic
1131888538 15:96947301-96947323 CTCCCACCTGGGCATGGAGGGGG - Intergenic
1132199977 15:99944628-99944650 ATCCCAACTGGGAAATGGGGTGG + Intergenic
1132413539 15:101604147-101604169 CTCCCAGTGGGGCAAAGAGGAGG - Intergenic
1133970408 16:10563803-10563825 CTCCCAACAGTCCAAGGGGTAGG - Intronic
1141752482 16:85968072-85968094 CTGGGAACGGGGCATGGGGGTGG + Intergenic
1142039135 16:87881397-87881419 GTCCCAAGGGGGCAAGGCTGAGG + Intergenic
1142336924 16:89495317-89495339 CTCACCACAGGGCCAGGGGGAGG - Intronic
1144735353 17:17552565-17552587 CCCCCAACCGGGAATGGGGGTGG - Intronic
1146655838 17:34634712-34634734 GACCCAACAGGGCAAGGGTGCGG + Intronic
1148490945 17:48023796-48023818 CGCCCACGAGGGCAAGGGGGTGG + Intergenic
1148686888 17:49506100-49506122 CAGCCAACTGGGAAAGGGGGAGG - Intronic
1148755564 17:49971434-49971456 CTCCCTACGGCTCAACGGGGTGG - Intronic
1150069152 17:62137731-62137753 CGCCCAGCGGGGCACGCGGGTGG - Intergenic
1150848986 17:68686799-68686821 ATCCCAGCGGGGCAGGGGGTGGG + Intergenic
1152906607 17:82973980-82974002 CGCCCCATGGGGCAAGGGGCTGG - Intronic
1153752058 18:8242504-8242526 ATCCCCACGGGGCAAGAGAGGGG + Intronic
1160726411 19:619720-619742 CGCCCAGCGGGGCATGCGGGTGG - Exonic
1163121447 19:15220648-15220670 CTCCCGATGGGGCAAGGGGAAGG - Intergenic
1163219315 19:15903080-15903102 CGCCCAGCGGGGCATGCGGGTGG - Intergenic
1163548491 19:17952523-17952545 CTCCTCACAGGGCATGGGGGTGG - Intronic
1166017243 19:39991554-39991576 CTCCGAAGGGTGCATGGGGGTGG - Intronic
1166198007 19:41219339-41219361 CTCCCAGCGGGGGAGGGGGCAGG - Exonic
1166546327 19:43636453-43636475 CACCCAGTGGGGCAAGGGGCAGG - Intronic
1167526022 19:49984343-49984365 CTCCCAGGTGGGCAAGGGGGAGG - Intronic
1167673968 19:50873365-50873387 GTGCCAACAGGGCAAGGGCGGGG + Exonic
925163156 2:1701022-1701044 TTCCCAGCGGGGCCAGGTGGTGG - Intronic
927713121 2:25338053-25338075 CTCCCAGTGGGGCACGGGGTGGG + Intronic
929456243 2:42068235-42068257 CTCCCAACGATGAGAGGGGGAGG - Intergenic
932275716 2:70450902-70450924 TTCCCAACGTGGCCAGGGTGTGG - Intronic
934868489 2:97837093-97837115 CTCCCAACGGGTCAACAAGGAGG - Exonic
937974489 2:127574069-127574091 CTCCCGACCTGGGAAGGGGGAGG - Intronic
948835841 2:240625596-240625618 CTCCCAGCGGGGCAGGGGCATGG + Intronic
1170421758 20:16200206-16200228 CTCCCAAAGGAGCAAGGAGATGG - Intergenic
1170930910 20:20768665-20768687 CTCCCCACGGGGCAGGGCTGGGG + Intergenic
1178798392 21:35767044-35767066 ATCCCCACGTGTCAAGGGGGGGG - Intronic
1179577772 21:42318407-42318429 CTCCCAAGGAGGAAAGGGAGAGG - Intergenic
1179912270 21:44456524-44456546 CTCCCAGCGGGGCAGGATGGCGG + Exonic
1181045108 22:20210677-20210699 CTCACAAAGCAGCAAGGGGGAGG - Intergenic
1182024716 22:27108992-27109014 CTCCCAGAGGGGGAAGGCGGGGG + Intergenic
1184448974 22:44571606-44571628 CTGCCACTGGGGCATGGGGGAGG - Intergenic
1185004111 22:48265289-48265311 CACCCCACGTGGCAAGAGGGAGG + Intergenic
952920593 3:38281488-38281510 CTCCCAAGGGGGCACAGGTGAGG + Intergenic
954792790 3:53145423-53145445 CTCCTAACTGGGCCAGGAGGAGG - Intergenic
956697651 3:71932253-71932275 CTCCCCACAGGTCAAGGGTGGGG - Intergenic
963044822 3:141094778-141094800 CTCCCAGGGGGGCAAAGGGGCGG - Intronic
966800725 3:183761534-183761556 CTCCCAATTGGGCAAAGAGGTGG - Exonic
969789381 4:9481500-9481522 CTCCCAATATCGCAAGGGGGGGG - Intergenic
969796752 4:9532911-9532933 CCCCCAGCAGGGGAAGGGGGGGG + Intergenic
973650191 4:52991456-52991478 CTACCAACTGGGCTAGGGGGAGG + Intronic
974961804 4:68711579-68711601 CTCCCAACGGAGGAAGGAGAAGG - Intergenic
978819065 4:112944580-112944602 GTCCCAATGGGGAAGGGGGGTGG - Intronic
980930257 4:139177356-139177378 CTCCCCACGCGGCGGGGGGGCGG + Intergenic
981271051 4:142847097-142847119 CTCTGCCCGGGGCAAGGGGGAGG - Intronic
983726892 4:170940372-170940394 CTCCCATGGGGGACAGGGGGTGG + Intergenic
983769955 4:171536822-171536844 CTGGCAAGGGGGAAAGGGGGAGG - Intergenic
985059367 4:186060980-186061002 CACAGAACGGGGCAAGGAGGTGG - Intergenic
985697128 5:1346924-1346946 CTCTCAACAGGGCAGGGGGACGG - Intergenic
986214530 5:5707063-5707085 CTCTCATGGGGGCAAGGGTGAGG - Intergenic
986255204 5:6096639-6096661 CACCCAACAGGGGAGGGGGGAGG + Intergenic
986856389 5:11873730-11873752 TTCCCAACTGGACAAGGGGCTGG + Intronic
991951365 5:71949513-71949535 CTGCCCTCGGGGCTAGGGGGTGG + Intergenic
998364370 5:141619116-141619138 CTACCAATGGGGGAAGGGAGAGG + Intergenic
999306280 5:150521533-150521555 CTCGCAACTGGGCCAGGAGGTGG + Exonic
1001293931 5:170485642-170485664 TTCCCAAAGGGGCCAGGGAGAGG + Intronic
1001771669 5:174301625-174301647 CTTCCAGCGGGACAAGGGAGGGG - Intergenic
1002159716 5:177307971-177307993 ATCCCAAAGGAGCAAGGGGCTGG + Intronic
1002896896 6:1384645-1384667 CTCCCAACGGGGGAAGAAGGGGG - Intergenic
1002897527 6:1388350-1388372 CTCCCAAGGGCTGAAGGGGGAGG - Intergenic
1003904574 6:10687720-10687742 CTGACAACGGGGCAAAGGTGTGG + Intronic
1005187669 6:23181050-23181072 CTCCAGACTGGGGAAGGGGGTGG + Intergenic
1008547283 6:52594371-52594393 CTCTCCAAGGGGCATGGGGGAGG + Intergenic
1010199286 6:73269003-73269025 CTTCCCACGGGGCAAGGGCTCGG - Intronic
1013740612 6:113279627-113279649 ATGCCAAAGGGGCATGGGGGAGG + Intergenic
1015854630 6:137610250-137610272 CTCCCAGCAGGGCAATGTGGAGG - Intergenic
1018710963 6:166497941-166497963 CTCCCAGCTGGGCAGGGGGCTGG - Intronic
1019427008 7:982690-982712 CTCCCCACGGGGCAAGGGACAGG - Intergenic
1020089934 7:5333274-5333296 CTTCCCATGGGGCAAGGGGCTGG - Intronic
1022904857 7:34845891-34845913 CTGCCAGAGGGGCAAGGAGGGGG - Intronic
1024266469 7:47610647-47610669 CTCCCAGCAGGGCAATAGGGAGG - Intergenic
1025998777 7:66545147-66545169 CTCCTCCCGGGGAAAGGGGGAGG + Intergenic
1031386677 7:121160459-121160481 CTCCCAGAGGGGGAAGGGAGAGG + Intronic
1034117825 7:148599958-148599980 CTCCCAAAGTGGCCAAGGGGTGG - Intronic
1035029956 7:155850296-155850318 CTCCCCATGGGGGAATGGGGTGG + Intergenic
1035117510 7:156537088-156537110 CTCCCAATGGGCCAAGAGGAGGG + Intergenic
1035455876 7:159008279-159008301 CTCCTAAGAGGGCAAGCGGGTGG + Intergenic
1039549544 8:38432910-38432932 ATCCCAACTGGGGAGGGGGGGGG - Intronic
1039566591 8:38556305-38556327 CTCCCCACAGGGCAAGGAGGTGG + Intergenic
1040782718 8:51129362-51129384 ATCCCCACGTGGCAAGGGGGGGG - Intergenic
1046753256 8:117946777-117946799 CTCCGAACGGTGCCAGGTGGTGG - Intronic
1047105252 8:121724554-121724576 TTCCCCAGGGGGCAAGGGAGGGG + Intergenic
1047204030 8:122789116-122789138 CAGCCAATGGGGGAAGGGGGTGG + Intronic
1049424006 8:142529411-142529433 CACCCAAGGGGGTATGGGGGCGG - Intronic
1051453899 9:17230510-17230532 CTCCTAAGGGGGTAAGGGGAGGG - Intronic
1056160780 9:83890316-83890338 CTCCCAATGGGGTATGAGGGAGG + Intronic
1056359357 9:85839006-85839028 CTCCCAATGGGGTATGAGGGAGG - Intergenic
1057194782 9:93110874-93110896 CTCCCCTCGGGGCCAGAGGGTGG - Intronic
1058429405 9:104904850-104904872 CACCCAACGGAGTAGGGGGGCGG - Intronic
1058475783 9:105331327-105331349 CTCCCAACAGGGCAAGGATCAGG - Intronic
1060282333 9:122222861-122222883 CTCCCAACGGGGCAAGGGGGAGG - Intronic
1060966525 9:127715044-127715066 CCCCCAGCGGGGCCAGGGCGAGG + Exonic
1062715159 9:138006477-138006499 CTCCCAACAGGAGAAGGAGGTGG - Intronic
1191221143 X:57989655-57989677 CTGCCAACTGGGAAAGGGTGGGG - Intergenic
1195378425 X:104249797-104249819 CTCCCAATGGGGCAGGGTAGAGG + Intergenic
1197324996 X:125081982-125082004 CTCCAAAAGGGGCAAGGAGGTGG + Intergenic
1198978405 X:142363745-142363767 CCAGCATCGGGGCAAGGGGGAGG - Intergenic
1199285085 X:146046330-146046352 CTCCCAACGGGGCAGGGCTTGGG - Intergenic
1200933101 Y:8715011-8715033 CCCCCAAAGGGGCAAGAGAGGGG + Intergenic