ID: 1060284778

View in Genome Browser
Species Human (GRCh38)
Location 9:122240012-122240034
Sequence CTGTGTGAATAAATGTAAGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 326}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060284778 Original CRISPR CTGTGTGAATAAATGTAAGA CGG (reversed) Exonic
900535880 1:3177114-3177136 ATGGGTGAATGAATGGAAGATGG - Intronic
904977922 1:34472703-34472725 CTGTGTGAATCAAGGGAGGATGG + Intergenic
905298037 1:36966863-36966885 CTTGGTGAATAAATGAATGAGGG - Intronic
905468567 1:38174862-38174884 CTGTGTGTATGACTTTAAGATGG + Intergenic
905978236 1:42196747-42196769 TTGTGCCAATAAATGTAAGAGGG - Intronic
908103015 1:60810674-60810696 CTGTTTGAATTCATGAAAGAAGG - Intergenic
909261482 1:73494870-73494892 GTGTGTGCATACATGTATGATGG + Intergenic
909787098 1:79627620-79627642 CTGTGTGAATAGAACTAGGATGG - Intergenic
910279985 1:85489142-85489164 CTTTGTGAATAAAGTTAAAATGG + Intronic
910733880 1:90430031-90430053 CTGTTTGTAGAAATGTAAAATGG - Intergenic
914748066 1:150513795-150513817 ATATGTGAATAAATTCAAGATGG - Intergenic
915684650 1:157619225-157619247 TTTTTTGAATAAATGTAAAAAGG - Intergenic
916505965 1:165428664-165428686 CTGGGTGAAACCATGTAAGATGG + Intronic
916764499 1:167847218-167847240 CTGTGTCTACTAATGTAAGAAGG - Intronic
917135718 1:171786441-171786463 CTGAGGGTATAAATGGAAGAGGG + Intronic
918504129 1:185233072-185233094 CTGATTGAATAAATCTGAGAGGG - Intronic
919371206 1:196728478-196728500 CAGTCTGCATAAATGGAAGATGG + Exonic
921446675 1:215255070-215255092 CTGTGTGAATATAGGTTATAGGG - Intergenic
924862013 1:247935316-247935338 CTGTATGTATAAATGAAATAAGG - Intergenic
1063157299 10:3391551-3391573 ATGTGTCCATAAATGTTAGAAGG + Intergenic
1063655192 10:7981258-7981280 GTGGGTGAATAGATGGAAGAGGG - Intronic
1064976183 10:21118387-21118409 CTGTTAGACTAAATGTAAAATGG - Intronic
1065628284 10:27653401-27653423 CTGTGTGGGTACATCTAAGAGGG - Intergenic
1067493409 10:46737360-46737382 CTGAGTGAATAAATCTTAGAAGG + Intergenic
1067601251 10:47603044-47603066 CTGAGTGAATAAATCTTAGAAGG - Intergenic
1068071923 10:52206709-52206731 CTGTGTGATTTAATGCTAGAGGG + Intronic
1068238457 10:54270741-54270763 CTGAGTGAATAAATCTTAGGAGG - Intronic
1068524071 10:58107422-58107444 CTGTCTGGAAAACTGTAAGATGG + Intergenic
1068922244 10:62496884-62496906 CAGTGAGAATAAATAAAAGAAGG - Intronic
1070109527 10:73470556-73470578 CTTTATAAATAACTGTAAGATGG - Intronic
1070197036 10:74167495-74167517 GTGAGTGAATAAAGATAAGATGG - Intronic
1070508019 10:77132966-77132988 CTCTGGAAATAAATGGAAGATGG + Intronic
1071652796 10:87410916-87410938 CTGAGTGAATAAATCTTAGGAGG - Intergenic
1073438987 10:103541298-103541320 CTGTGTGAAGAAAAATAAGGAGG + Intronic
1073603029 10:104865225-104865247 CTGTGTGAAAGAAGGAAAGAAGG + Intronic
1073653635 10:105388427-105388449 TTGTGTGTATATATGTATGAAGG - Intergenic
1073982416 10:109169556-109169578 CTGTGTAAGTTAATGTAAGTTGG - Intergenic
1074677388 10:115867622-115867644 CTATGTTAAAAAATATAAGATGG - Intronic
1075936695 10:126348494-126348516 ATGTGGGAACAAATGCAAGAGGG + Intronic
1076726312 10:132415592-132415614 GTGTGTGAGTAAATGTGAGTGGG - Intronic
1076726342 10:132415931-132415953 GTGTGAGCATGAATGTAAGAGGG - Intronic
1077009151 11:372555-372577 CTGTGTGGATACATGTTGGAAGG + Intronic
1077741615 11:4852418-4852440 CTGTGTGAAGAACTGTAGGCTGG + Intronic
1079814885 11:25043041-25043063 CTGTGGGAATAGTTCTAAGATGG + Intronic
1080092542 11:28365686-28365708 GTATGTGAAAAAATGTATGAGGG + Intergenic
1080280964 11:30555984-30556006 CTGAGTGGAAAAATTTAAGAAGG - Intronic
1082645108 11:55714214-55714236 ATGTGTGATTAAATGTAGGGAGG + Intergenic
1082727030 11:56748409-56748431 CTGTGTGAGTGAATATATGATGG + Intergenic
1082942303 11:58719745-58719767 CTCTGTGATTCAATGTTAGAAGG + Intronic
1084343538 11:68526565-68526587 GTGTGTGAATAGAGGTAAGATGG - Intronic
1086579049 11:88375415-88375437 CTATAGGAAAAAATGTAAGAAGG - Intergenic
1086722082 11:90133625-90133647 ATGTGTGTATAATTTTAAGAGGG + Intronic
1087426007 11:97986976-97986998 CTGTGAGAATAAAAATTAGATGG - Intergenic
1088097594 11:106118152-106118174 GTGTGTGAATAACAGCAAGAAGG - Intergenic
1088209410 11:107437584-107437606 CTTTCTGAATAAACATAAGATGG + Intronic
1090999636 11:131898642-131898664 CTTGTTGAATAAATGTGAGAAGG + Intronic
1091767969 12:3134241-3134263 CTGTGTGAATGAATGGGTGATGG + Intronic
1092697935 12:11194435-11194457 CTGTGTGTATGAATGTAATATGG + Intergenic
1093293723 12:17361707-17361729 CTTTCTGACTAAAGGTAAGATGG + Intergenic
1094070558 12:26408249-26408271 CTATGTGAAAAAATGAATGAAGG + Intronic
1094688066 12:32739942-32739964 CTGTCTGAATAAACTTCAGATGG + Intronic
1095173765 12:39066200-39066222 CAGTTTGAATAAATGTAGAAAGG + Intergenic
1097028254 12:56074494-56074516 CTGACTGAATAAATGAAAGAAGG - Intergenic
1097487150 12:60218076-60218098 GTGTGTGTATATATGTAAAATGG - Intergenic
1097922524 12:65091821-65091843 CTGGGTGAATGAATAAAAGAAGG - Intronic
1098202033 12:68066486-68066508 GAGTGTCATTAAATGTAAGATGG + Intergenic
1098904448 12:76147593-76147615 TTGTGAGAACAAATGGAAGAAGG - Intergenic
1099592962 12:84619609-84619631 CTGTGTGCATATATGAAATAGGG + Intergenic
1100249601 12:92804745-92804767 TTGGGTGTATAAATGTAAGGGGG + Intronic
1100915797 12:99420401-99420423 TTCTGTGAATAAATTTAAGATGG + Intronic
1101841986 12:108334333-108334355 CTGTGTGAATAAATGCATGTGGG - Intronic
1102628998 12:114260440-114260462 CTGATTGAATAAATGAATGAAGG + Intergenic
1102817358 12:115878015-115878037 CTGAATGAATAAATGTAACTTGG - Intergenic
1104158715 12:126158186-126158208 CTGTTGGAAGAAATGTAAAATGG - Intergenic
1105672470 13:22634962-22634984 GTGTGTCTTTAAATGTAAGATGG + Intergenic
1107122563 13:36811654-36811676 CTGTTTGCAGAAATGTAAGCAGG + Intergenic
1108287999 13:48927770-48927792 CTGGGTGAAGAATTCTAAGATGG - Intergenic
1108290416 13:48954646-48954668 ATGAATGGATAAATGTAAGATGG - Intergenic
1108296346 13:49022010-49022032 CTGGGTGAACAATTGTAAAAAGG + Intronic
1108413303 13:50172121-50172143 CTTTGTGAAAATGTGTAAGAAGG + Intronic
1108891159 13:55261549-55261571 CTGTGTAAATAAATGAAGCATGG + Intergenic
1109294939 13:60518597-60518619 CTTTGTAAATACATGTAAAAAGG + Intronic
1110043273 13:70793587-70793609 CTGACTGAATAAATATATGAAGG + Intergenic
1110206238 13:72917793-72917815 CTATGTGAATAACTGTATTAAGG - Intronic
1111678976 13:91420981-91421003 ATGTGTGAATAAATTTATGTTGG + Intronic
1112210436 13:97371821-97371843 CTGTCTAAATAAATGTCACATGG + Intronic
1112218194 13:97458195-97458217 CTGTGTGAAAAGATGAATGAGGG + Intronic
1112527015 13:100159590-100159612 CTTTGTAAATGAAAGTAAGAAGG + Intronic
1115015798 14:28612165-28612187 TTGTGTCAATAAAGGTAAAATGG - Intergenic
1115202246 14:30867451-30867473 AAGTTTGAATAAATGCAAGAAGG - Intergenic
1115402991 14:32984404-32984426 CTTTGGGAAAAAAAGTAAGAGGG + Intronic
1115870476 14:37795447-37795469 CTGGGAGATTAAATGTAAAATGG - Intronic
1118646819 14:67848467-67848489 CTGTGGGATTACATGTGAGATGG + Intronic
1120428987 14:84389834-84389856 CTGTGGGAACAGATGTAAGTTGG - Intergenic
1121711987 14:96045358-96045380 CTGTGTGCACAAAGGCAAGAAGG + Intronic
1122496200 14:102157352-102157374 ATGTGTGATTGAATATAAGAAGG + Intronic
1122689305 14:103524092-103524114 CTCTGTGAATAAAGCAAAGAAGG + Intergenic
1123815315 15:23972242-23972264 CTAAGTGAAAAAATGTAAGTTGG - Intergenic
1123844479 15:24284160-24284182 CTATGTGAAAAAATATAAGTTGG - Intergenic
1123929790 15:25160328-25160350 CTTTGTGAATAATTGTAACTGGG - Intergenic
1124229832 15:27934875-27934897 CAGTGCGATTAAAAGTAAGAGGG - Intronic
1125101094 15:35913629-35913651 CTGAATGAATAAATGGTAGATGG - Intergenic
1126801162 15:52297757-52297779 ATGTGTGAATAGAGGTAAGGAGG + Intergenic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1129675043 15:77628013-77628035 CTGATTGAATGAATGTAAGATGG - Intronic
1129940909 15:79495686-79495708 CTGTGTGAGTATATGTAAAGTGG + Intergenic
1129940925 15:79495968-79495990 CAGTGTGAGTATATGTAAGGGGG + Intergenic
1130437653 15:83917912-83917934 CTGTATTAATAAATGTTAGTGGG + Intronic
1130683040 15:86013173-86013195 CTGTGTGGATAATTGAAAGCTGG + Intergenic
1130830125 15:87590873-87590895 TTGTGTGAAGAATAGTAAGAAGG + Intergenic
1132297841 15:100755352-100755374 CTTTGTGAACAAATGGAACAAGG + Intergenic
1133371811 16:5251031-5251053 TAGTGTGAATAAAAGAAAGAGGG - Intergenic
1133792805 16:9022244-9022266 CTGTGTTGATAAATGACAGAGGG + Intergenic
1134449117 16:14353103-14353125 TGGTGTGAATGAATGTAAGACGG - Intergenic
1135354246 16:21756420-21756442 CTTTGGGGATAAATGTGAGACGG - Intronic
1135452738 16:22572561-22572583 CTTTGGGGATAAATGTGAGATGG - Intergenic
1136026594 16:27472659-27472681 CTTTTTCAAGAAATGTAAGAAGG - Intronic
1137732789 16:50701157-50701179 CTGGCTGAATAAATGAATGATGG - Intronic
1141335482 16:83151092-83151114 CTGGGTGAATAAAGGTAGTAAGG - Intronic
1141434443 16:83991651-83991673 CTGTGTCAATAAATAAAATAAGG - Intronic
1143397127 17:6609733-6609755 ATGTGTGATTGAATGGAAGATGG - Intronic
1143987214 17:10925328-10925350 CTTTGTGAATGAATGTTTGAGGG - Intergenic
1144132119 17:12256168-12256190 CTGTGTGTAAGAATGTAAGAAGG - Intergenic
1145971979 17:28961501-28961523 ATGAGTGAATGAATGTAAAAAGG + Intronic
1146086217 17:29832442-29832464 ATGTTTGAATAAATGAATGATGG + Intronic
1146695873 17:34908854-34908876 GTGAGTGAATAAATGGATGAAGG - Intergenic
1146921336 17:36714578-36714600 TGGTGTGAATAAATAAAAGAGGG - Intergenic
1148061653 17:44840858-44840880 CTGAGTGAATAAGTGAATGAAGG + Intergenic
1152259915 17:79261305-79261327 ATGTGTGAGTAAATGAAGGAGGG + Intronic
1203192586 17_KI270729v1_random:203922-203944 TTGTATAAAAAAATGTAAGAAGG + Intergenic
1203201951 17_KI270730v1_random:3357-3379 TTGTATAAAAAAATGTAAGAAGG + Intergenic
1152986607 18:327186-327208 GTGTGTGTGTGAATGTAAGATGG + Intronic
1153420625 18:4900941-4900963 CACTGTGAATAAATGTCAGTAGG + Intergenic
1154073540 18:11177473-11177495 CTGACTGAATAAATGTTAAATGG + Intergenic
1155737505 18:29242273-29242295 CTGGGTGAGTAAAGGTCAGAGGG + Intergenic
1158028344 18:52930713-52930735 ATGTTTCAATAAATGTATGAAGG - Intronic
1158604649 18:58884696-58884718 CTGTGTGAATACTAGTAACAAGG - Intronic
1160526564 18:79542096-79542118 GTGGGTGAATAAATGGATGAAGG - Intergenic
1165981519 19:39728354-39728376 GTGTGTGAGTGAATGTAAGGGGG - Intergenic
1166201546 19:41240636-41240658 GTATGTGAAGAAATGTAGGAAGG - Intronic
1166214582 19:41326923-41326945 GTGTGTGTATATGTGTAAGACGG - Intronic
1166935767 19:46331542-46331564 CTCTGCAAATACATGTAAGATGG + Intronic
1167881065 19:52457702-52457724 CTCTGTGACTAAATGTATGTGGG - Intronic
925627051 2:5851985-5852007 CTGAATGACTAAATGTAGGATGG - Intergenic
926147558 2:10405856-10405878 CTTTGGGAGAAAATGTAAGAGGG - Intronic
926617394 2:15010746-15010768 TTGTGTTAATATATGTAATAGGG - Intergenic
927401203 2:22713070-22713092 GTGTGTCATTAATTGTAAGATGG + Intergenic
928922183 2:36537625-36537647 CCGTGTGAACGAATGAAAGAAGG - Intronic
930395043 2:50811271-50811293 GTGTGTGAATAACTGAGAGATGG - Intronic
931259230 2:60602607-60602629 CTGTGTGCCCAAATGTAAAAGGG + Intergenic
931306057 2:61029566-61029588 ATGTGTGAATAAATATAATTTGG + Intronic
931421937 2:62136143-62136165 CAGTGTGCATAAATGTTATAAGG + Exonic
932598937 2:73111301-73111323 CTGAGTGAATAAATCCAGGAAGG - Intronic
932708022 2:74041843-74041865 CTGTGCAAATAAATTAAAGATGG - Intronic
934676099 2:96250689-96250711 CTGTGTGATCAAATGTATGAAGG + Exonic
935568440 2:104634339-104634361 CAGTGTGAATAAATAAATGATGG - Intergenic
936790529 2:116145555-116145577 AAGTGTTGATAAATGTAAGAAGG + Intergenic
937052723 2:118905505-118905527 CGGGGCGAATAAATGCAAGAAGG - Intergenic
937299268 2:120829166-120829188 ATGTGTGTATAAGTGTATGAAGG - Intronic
937318344 2:120946256-120946278 GAGCGTGAAGAAATGTAAGAAGG + Intronic
937648170 2:124288891-124288913 TTGTGTGAATAAATGAAAATTGG + Intronic
939091821 2:137788916-137788938 CTGTGAGAATTAAAGTATGATGG + Intergenic
939565786 2:143785146-143785168 CTGTGTTCATGAATGTAAAATGG - Intergenic
939766265 2:146253719-146253741 TTGTGTGAATGAGTGTTAGATGG + Intergenic
940039861 2:149348780-149348802 CTGTGAGAATAAATATAGGAAGG + Intronic
940113225 2:150178592-150178614 ATGGGTGAATAAAACTAAGAAGG + Intergenic
941017868 2:160377501-160377523 CTGTGTGAATGAATTTGGGAAGG + Intronic
941368832 2:164638908-164638930 CTTTTTGAATAAAAGTAGGATGG + Intergenic
941734237 2:168955662-168955684 CTGTGTTTTGAAATGTAAGAAGG - Intronic
942331751 2:174832687-174832709 CTGTATCAATAAATGTAGAAGGG - Intronic
942766206 2:179460277-179460299 CTGTGAGAATAGAAGCAAGATGG - Intronic
942960191 2:181821108-181821130 CTCTGTGAATAAGTTTAACAAGG - Intergenic
943204187 2:184870137-184870159 CTATATAAATAAATGTAAAAAGG + Intronic
944215406 2:197249448-197249470 CTGTTTGAATAAAAGTATGTTGG - Intronic
944272898 2:197804022-197804044 CAGTGTGAGTAAATATAACAAGG - Intergenic
944658381 2:201899484-201899506 CTGTGTGGATATTTGGAAGAGGG - Intergenic
944791534 2:203134125-203134147 CTGTTTGTATAAATGTAAACTGG - Intronic
945010787 2:205461312-205461334 ATGTGTGAAGAAGTGAAAGAAGG + Intronic
946540231 2:220676238-220676260 CTGTGTGAAGACATTTAAGAAGG + Intergenic
948647329 2:239414055-239414077 TTGTGTGAGTAAATCTAAGCAGG + Intergenic
1170008060 20:11690436-11690458 CTGTGTGAATTGATGAATGAAGG - Intergenic
1173653306 20:44681515-44681537 ATGTGTGAACAAATGCAGGATGG + Intergenic
1173896876 20:46557845-46557867 TTGAATGAATAAATGGAAGAAGG + Exonic
1173951378 20:46996123-46996145 CTGCGTGAATGAATGAAACATGG + Intronic
1174577279 20:51545515-51545537 ATGTGTGGATAAATGGAGGATGG + Intronic
1175020065 20:55836673-55836695 CTGTCTGAATAAGAGTTAGATGG + Intergenic
1176916271 21:14629465-14629487 CTGTGAGAATAAAATGAAGAAGG + Intronic
1177541664 21:22500910-22500932 CAGTCTGAATAATTGTAACAAGG + Intergenic
1177569192 21:22864398-22864420 CTGTGTGAATGTCTTTAAGATGG - Intergenic
1177944220 21:27447146-27447168 CAGTGTGAATAAATTCTAGAGGG - Intergenic
1179145249 21:38762470-38762492 CTGTGTGAATATCCTTAAGAAGG - Intergenic
1179316735 21:40250539-40250561 CTTTGTGAGAAAATGTAAAATGG - Intronic
1182511387 22:30822687-30822709 CTGCCTGAATAAATTTAAGAAGG + Intronic
1182966271 22:34524343-34524365 CTGTGTGTATATATGTGTGATGG - Intergenic
1183305457 22:37080653-37080675 CTGTGTGAATGAATGTGGAAGGG - Intronic
1184892036 22:47386022-47386044 CTGGATGAATAAATGAAGGAAGG - Intergenic
949822773 3:8134060-8134082 CTGAATGAATAAATGACAGAAGG - Intergenic
951865507 3:27302707-27302729 CTCTGTGCCTAAATGTAACATGG + Intronic
952273352 3:31853653-31853675 CTGTGTGAATAATAATAAGTAGG - Intronic
953459595 3:43072018-43072040 ATGAGTGAATGAATATAAGAAGG - Intergenic
953731297 3:45450789-45450811 CTGTGTGAAAAACAGTAAGGTGG - Intronic
953734010 3:45475839-45475861 GTGTTTGAATAAATGCATGAAGG + Intronic
954891609 3:53935516-53935538 CAGTGTGAGTAAATGTATGTAGG + Intergenic
954897719 3:53991150-53991172 CTGTCTCAAAAAATATAAGAAGG - Intergenic
955399924 3:58584337-58584359 CTGGATGAATAAATGAATGAAGG + Intronic
958136883 3:89505250-89505272 CTGTTTGAATGAAGGTAAGATGG + Intergenic
958602804 3:96319717-96319739 CTATGTGATAAAATGTCAGATGG - Intergenic
958984245 3:100761948-100761970 CTGTTTGAATAACTGGAAGATGG - Intronic
959370565 3:105520274-105520296 CTGTGAGTACAAATGTAGGAAGG + Intronic
960370730 3:116835050-116835072 CTGTGACATTAAATGTGAGATGG - Intronic
961697007 3:128712381-128712403 CTGAATAAATAAATGAAAGATGG + Intergenic
962616615 3:137133046-137133068 CTGTGTGTTTATATGTAAAATGG + Intergenic
962740526 3:138360112-138360134 CTGTGTCAATAAGTGATAGAAGG - Intronic
963497790 3:146089597-146089619 GTGTATGAAAAAATGGAAGAAGG - Intronic
963512501 3:146266009-146266031 CTGTGTGAATATAAGGAAAATGG + Intergenic
963766931 3:149346933-149346955 GACTTTGAATAAATGTAAGAAGG + Intergenic
963789005 3:149564142-149564164 CTGTGTCAGTAAATGTAGGGTGG - Intronic
965780231 3:172278241-172278263 CTGCTTGAAAAAATGTAATATGG + Intronic
966227495 3:177613728-177613750 CTGTGTGAATGCAGGTAACAGGG - Intergenic
967190323 3:186979126-186979148 TTGTGTGAACAAATGAATGAGGG + Intronic
968736979 4:2302726-2302748 GTGAGTGAAGAAATGAAAGACGG + Intronic
969585261 4:8087874-8087896 CGCTGTGAATAAATGTGAGGAGG - Intronic
970491553 4:16580259-16580281 CTTTGTGTACAAATGAAAGAAGG + Intronic
970609327 4:17710696-17710718 CTGTGTGAAGAACTGAATGAAGG + Intronic
970703414 4:18770621-18770643 CTGTTTTACTAAATGTAAGTTGG + Intergenic
971117606 4:23665979-23666001 CTCTGGGAATAATTGAAAGAAGG - Intergenic
971182215 4:24339464-24339486 CAGTGTGAACAAAGGTAAAAAGG - Intergenic
971451697 4:26806949-26806971 GTGAGGGAATAAATGTCAGAAGG + Intergenic
974012679 4:56621920-56621942 GGGTTTGAATAAATGTATGATGG - Intergenic
974267899 4:59609481-59609503 CTGAGAGAATAAATTTAAGAAGG + Intergenic
974516363 4:62918348-62918370 CTGTAAGATTAACTGTAAGATGG - Intergenic
974618525 4:64323571-64323593 CTGTGTGAAAAATAGAAAGAAGG + Intronic
975895297 4:79082965-79082987 AGGTATGAATAACTGTAAGATGG + Intergenic
976839563 4:89415671-89415693 TTTTGTTAATAAATGTAATATGG + Intergenic
977145700 4:93437704-93437726 GAGTGTGATTAAATGCAAGAGGG - Intronic
977477439 4:97530356-97530378 CTGTGTAAATAACTGTGCGAAGG + Intronic
977829343 4:101571866-101571888 CTGAATGAATAAATGAATGAAGG + Intronic
978113450 4:104990934-104990956 TTGAGTGAATAAATGTATGATGG - Intergenic
978326106 4:107558336-107558358 CTGTGTCAATAAATGTAAATAGG - Intergenic
979032124 4:115662936-115662958 CTGTTCGACTTAATGTAAGAAGG - Intergenic
979269027 4:118737614-118737636 CTATGTCAATAAAAGTTAGATGG - Intronic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
980466176 4:133186302-133186324 CTGAATGAATAAAATTAAGAAGG + Intronic
981821765 4:148895336-148895358 CTGTGTGAATATGTTTTAGAAGG + Intergenic
981951677 4:150416875-150416897 TTGTGAGATTAAATGTAATAAGG - Intronic
982107092 4:152020594-152020616 TTGAGTGAATAAATGTAAGGTGG + Intergenic
982646372 4:158028604-158028626 GTGTGTGATTATATGTGAGATGG - Intergenic
982826916 4:160013719-160013741 CTTTGTGAATCAATATCAGAGGG + Intergenic
983095240 4:163553503-163553525 CTATGTGAACAAAGATAAGAAGG + Intronic
983332896 4:166354185-166354207 CTGTGTAAGTACATGTAGGATGG + Intergenic
984055267 4:174920691-174920713 CTGGATGAATAAAGGAAAGAAGG + Exonic
984602109 4:181739722-181739744 CTGTGATAATAAATGTACGACGG - Intergenic
984841672 4:184073885-184073907 CTGTGTTACTAAATGTCATAGGG - Intergenic
985901764 5:2801604-2801626 CAGTGTGAATAATTGTCAAAAGG - Intergenic
988273835 5:29054670-29054692 TTCTGTTAATAAATGTAAGGAGG - Intergenic
988801545 5:34700530-34700552 ATGAGTGACTAAATGTAAAATGG + Intronic
989563150 5:42873917-42873939 GTGTGTGAGTGTATGTAAGAGGG - Intronic
990683033 5:58267407-58267429 CCGAGTGAATAAATGAAGGAAGG + Intergenic
993523745 5:88938504-88938526 GTGTGTGAATGAATGAAGGAAGG + Intergenic
993827302 5:92707409-92707431 TTATAAGAATAAATGTAAGAAGG - Intergenic
993918906 5:93775680-93775702 CTGTGGGAAAACATGCAAGATGG - Intronic
996620887 5:125501278-125501300 GTGTGTGTATATATATAAGAGGG - Intergenic
996926671 5:128835101-128835123 TTGAGTGAATTAATGAAAGAAGG + Intronic
998772154 5:145557949-145557971 CTGTGAGAACAAAAGTAAGATGG + Intronic
1001007176 5:168062992-168063014 CACTGTGAATAACTGTAAGGTGG - Intronic
1001299190 5:170521882-170521904 CTGAGTGACTACATGGAAGAAGG - Intronic
1001348001 5:170925322-170925344 CTGTGTGACTTAACGCAAGATGG - Intronic
1005059857 6:21765648-21765670 ATGTGTTTATGAATGTAAGAAGG - Intergenic
1005827613 6:29644240-29644262 CTGTCTGAATAATTATAAGTAGG + Intergenic
1006057654 6:31397315-31397337 CTTTGAGAATAAATGGAACAGGG + Intergenic
1006070136 6:31492315-31492337 CTTTGAGAATAAATGGAACAGGG + Intergenic
1006865624 6:37206970-37206992 CTGTATGAAGAAAAGTAGGACGG + Intergenic
1008249609 6:49223969-49223991 AAATGTGAAGAAATGTAAGAAGG - Intergenic
1009335857 6:62490610-62490632 GTCTGTGTATAAATGTAAGAAGG - Intergenic
1011122493 6:83968884-83968906 ATGTGTGAATAACTGAAACAAGG + Intergenic
1011344060 6:86349561-86349583 CTGTGTGGATAACTGGAAGGAGG - Intergenic
1012411320 6:98961115-98961137 CTTTGTGTATAAATTTGAGAAGG - Intergenic
1012603331 6:101126181-101126203 CTCTGTGAATAGAAGAAAGAAGG - Intergenic
1013855703 6:114569518-114569540 CTGTGGGTAGAAATGTAAAATGG - Intergenic
1013857591 6:114592637-114592659 CTGTGTGAACAAGTCTAGGATGG + Intergenic
1013876802 6:114841003-114841025 GTGTGTCAATACATGTGAGATGG - Intergenic
1014868063 6:126556360-126556382 CTATGTGAATAGATGTCAAAGGG + Intergenic
1014914602 6:127130918-127130940 GTGTGTGAATTAAAGTCAGAGGG - Intronic
1015070745 6:129089427-129089449 CAGGGTGAATAAATTTTAGAAGG + Intronic
1015738365 6:136425877-136425899 CTGTTCGAATAAATGCAAGTAGG - Intronic
1016434845 6:144025335-144025357 CTTTGTGACTAAATGTAATGAGG + Intronic
1016892041 6:149016475-149016497 GTGAGTGAATAAATGGCAGAAGG - Intronic
1018646300 6:165951822-165951844 TTGAATGAATAAATGGAAGAAGG - Intronic
1019869832 7:3749917-3749939 CTGTGTGAATCAATATAAATTGG + Intronic
1020398431 7:7745547-7745569 TTTTGGGAATAAATATAAGATGG + Intronic
1022015668 7:26346497-26346519 CTGTGTGAATCAAAATAAGTGGG - Intronic
1022139709 7:27482691-27482713 CTGTCTGAATTACTGTAAGGTGG + Intergenic
1023561761 7:41481379-41481401 CTATGAGAATAAATGCAAGTAGG + Intergenic
1024030274 7:45454892-45454914 CTGTGTAACTTAATGTCAGAGGG + Intergenic
1027425196 7:78054983-78055005 TTGTGTGAATGAATGAAATAAGG - Intronic
1027577701 7:79951342-79951364 CAGCGTGAACAAATGCAAGATGG - Intergenic
1028639250 7:93024586-93024608 CTGCGTGATTAAATGAAAGAAGG + Intergenic
1030318497 7:108140667-108140689 CTGTGTGAAGAAAAGAAAGGGGG + Intergenic
1030913684 7:115285136-115285158 ATATGTGAATAAATGTAGGGAGG - Intergenic
1030972773 7:116081009-116081031 GTGTGTGTATAAATATAAAATGG + Intronic
1031325728 7:120394733-120394755 CTGTGAGACTAGAAGTAAGATGG + Intronic
1031684806 7:124720450-124720472 CTGTGTAAACAAATGTAAGGTGG - Intergenic
1032502013 7:132406793-132406815 CTCTGTGAATGAAGGTAAGAAGG + Intronic
1034930557 7:155158238-155158260 CTCTGTCAAAAAATGAAAGAAGG + Intergenic
1036093018 8:5689972-5689994 CTTTGTGTACAAAGGTAAGATGG + Intergenic
1036798266 8:11771211-11771233 CTGCATGAAGAAAGGTAAGAGGG + Intronic
1037546582 8:19929777-19929799 TTGTCTGAATAAAATTAAGAAGG - Intronic
1038207270 8:25478424-25478446 CTGTGTGAAAAACTGTAACAGGG - Intronic
1038995400 8:32917342-32917364 CTGTCTGGATAATTGTATGAAGG - Intergenic
1040480387 8:47820853-47820875 CTTTGTCAATAAATGTCAGCAGG + Exonic
1040702547 8:50084857-50084879 CTGTGTCATAAAATGTCAGAAGG - Intronic
1041406648 8:57506588-57506610 ATGCCTGAATAAATGAAAGATGG + Intergenic
1041938623 8:63362162-63362184 ATGTTTGAATAAATTTAAAAGGG + Intergenic
1042774236 8:72412143-72412165 CTTTCTTAATAACTGTAAGAAGG + Intergenic
1042860845 8:73312135-73312157 GTGTGTTAAAAAATGTAAAATGG - Intronic
1043528863 8:81127949-81127971 CAGTATGAGCAAATGTAAGAAGG + Intergenic
1043930876 8:86090322-86090344 CTGTGTGTATATATATAAAATGG - Intronic
1044392945 8:91673943-91673965 ATGCATGAATAAATGAAAGAAGG - Intergenic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1045462948 8:102442254-102442276 CTATGTTAATAAATACAAGATGG + Intergenic
1046324560 8:112623894-112623916 ATGAGTGAATAAATGAATGAAGG + Intronic
1046758902 8:118000194-118000216 CTGTGTGTATAAAAGACAGATGG + Intronic
1047455604 8:125007056-125007078 CTCTGTGTATGAATGTATGAGGG + Intronic
1047946124 8:129882637-129882659 CTGTGTGCATACACGTAAAAAGG - Intronic
1051559346 9:18422895-18422917 CTGTGAGAAAGAATGTTAGAGGG - Intergenic
1052165685 9:25324640-25324662 AATTGTTAATAAATGTAAGATGG - Intergenic
1055254168 9:74346302-74346324 ATGTGTGTATATATGTATGATGG - Intergenic
1055254169 9:74346336-74346358 ATGTGTGTATATATGTATGATGG - Intergenic
1055420585 9:76136981-76137003 ATGTCTGAAGAAATGTAAGGAGG - Intronic
1055962765 9:81836044-81836066 GTGGGTGAATCAATGTTAGACGG + Intergenic
1057134295 9:92676210-92676232 CTGTGTTTAGAAATGCAAGATGG + Intergenic
1057491307 9:95522086-95522108 CTGTCTGGATATATGTGAGAAGG - Intergenic
1057745074 9:97745000-97745022 CTGTTTGAACATATGTAGGATGG - Intergenic
1058336967 9:103841977-103841999 CCTTCTGAATAAATGTGAGAAGG + Intergenic
1058656547 9:107227258-107227280 TTGTGTGAATAATTGTAAATAGG - Intergenic
1060284778 9:122240012-122240034 CTGTGTGAATAAATGTAAGACGG - Exonic
1061244707 9:129395492-129395514 ATGGGTGAATGAATGGAAGATGG + Intergenic
1061333729 9:129915047-129915069 CTGAGTGAATAATTCTAAAAAGG + Intronic
1061369593 9:130191018-130191040 GTGTCTGAATAAAAGTCAGAGGG - Intronic
1185913034 X:4003352-4003374 CTGTGTTCTTAAATGGAAGAAGG - Intergenic
1188900172 X:35722622-35722644 TTGTGTGTAGAAATGTAAAATGG - Intergenic
1190459684 X:50660050-50660072 GTGTGTGAAGACATGTAAAAAGG - Intronic
1191666121 X:63704584-63704606 ATGGGTGAATAAATTTAAAAAGG + Intronic
1192857081 X:75023685-75023707 GTGTGTCAATGTATGTAAGATGG + Intergenic
1192924232 X:75738659-75738681 CTATGTGGATAACTGCAAGAGGG - Intergenic
1193012007 X:76687253-76687275 CTGTGTGATTAGCTGTGAGATGG + Intergenic
1193729664 X:85087395-85087417 CTATGTGAAAAAATGAAACAAGG - Intronic
1194489464 X:94528744-94528766 CTGTTGGACTAAATGTAAAATGG - Intergenic
1195491454 X:105475097-105475119 ATGAGAGAATAAATGTAAAAGGG + Intronic
1198579419 X:138047493-138047515 ATGAGTGAATAAATGAAGGAGGG + Intergenic
1198722774 X:139641785-139641807 CTATATGAATAAATGAATGAAGG + Intronic
1199096521 X:143747812-143747834 CTGACAGAATAAATGTATGAAGG + Intergenic
1199096922 X:143754368-143754390 ATGTGTGACTAAATGCATGACGG - Intergenic
1199343755 X:146714014-146714036 CTGTGAAAATAAATGTAACACGG - Intergenic
1199828431 X:151524004-151524026 GTGTGTGAATAAGTTTAAGGAGG + Intergenic
1200781624 Y:7221469-7221491 ATGTATGAATAGATGTAAAATGG + Intergenic
1202096666 Y:21258329-21258351 CTTTGTGAAAAACTGTAAGAAGG - Intergenic