ID: 1060284903

View in Genome Browser
Species Human (GRCh38)
Location 9:122241848-122241870
Sequence CTGTAGCAGCAAAAGCAAAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 255}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060284903_1060284905 26 Left 1060284903 9:122241848-122241870 CCAATTTGCTTTTGCTGCTACAG 0: 1
1: 0
2: 2
3: 21
4: 255
Right 1060284905 9:122241897-122241919 TTCCATGCTGTTCTAGAATATGG 0: 1
1: 0
2: 1
3: 17
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060284903 Original CRISPR CTGTAGCAGCAAAAGCAAAT TGG (reversed) Exonic
903728855 1:25474476-25474498 CTGAAGAAGAAAAAGCAAAAAGG - Intronic
904057302 1:27679912-27679934 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
904406659 1:30294982-30295004 CTGTAACAGAAAAAGGAAATAGG + Intergenic
905425232 1:37878446-37878468 CTGAGGCAGCAAGAGCAATTCGG + Intronic
906112593 1:43334180-43334202 GTGTGGAAGCAAAAGAAAATGGG + Intergenic
907603105 1:55789631-55789653 CTGAATCACCAAAAGCAAGTTGG - Intergenic
907714938 1:56917559-56917581 CTGCAGGAGCCAAAGCAGATGGG + Exonic
909227711 1:73045888-73045910 CTGTTGTAGCTAAAGCAAGTGGG - Intergenic
909938477 1:81582512-81582534 CTGTAGCATCAAAAGTATAAAGG + Intronic
909958820 1:81810998-81811020 TTGTAGTAGAAAAAGCAAAGTGG - Intronic
910954018 1:92681941-92681963 CTGTAGTAGCATAGGCAAATAGG - Intronic
912469688 1:109898027-109898049 AGGGAGCAGCAAAAGCAAAGTGG - Intergenic
913396277 1:118375966-118375988 CTGTAAAATCAAAAGCAAATTGG + Intergenic
914429236 1:147604877-147604899 ATGTAGAAGAAATAGCAAATTGG + Exonic
914960877 1:152205843-152205865 CTGCAGCTGGAAAAGCAAGTTGG - Intergenic
915427313 1:155837398-155837420 CCGTAGCAGCAAATGTGAATTGG - Intronic
915873686 1:159589137-159589159 TTGTAGCTGGAAAAACAAATAGG - Intergenic
916539706 1:165740951-165740973 CTGTTACAGCAACAGAAAATGGG + Intronic
918532226 1:185536637-185536659 TTGTAGCAGCAAAAACTACTAGG - Intergenic
919207193 1:194432634-194432656 ATGTAGAAGTAAAAGTAAATAGG + Intergenic
919371840 1:196738420-196738442 CTGTAAAATCAAAAGCAAGTTGG + Intronic
920947714 1:210545308-210545330 TTGTGGCAGCAAGAGAAAATGGG - Intronic
924720563 1:246619227-246619249 CCATAGCAGCAAAACCAAAAGGG - Intronic
1063383584 10:5602094-5602116 CTGCAGCAGGAATAGCACATTGG - Intergenic
1064373680 10:14776406-14776428 CTGTAGCAACCAAGTCAAATGGG - Intergenic
1065179664 10:23112235-23112257 CAGTAGCAGCAACAGGAAAGGGG - Intronic
1068012386 10:51468948-51468970 CTGTAACACCAATTGCAAATGGG + Intronic
1069301743 10:66916486-66916508 CTGTAGCTTAAAAAGCAAATAGG - Intronic
1070637727 10:78142549-78142571 CTGTAAAACCAAAAGCAAGTTGG - Intergenic
1071942111 10:90601496-90601518 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
1072820225 10:98549517-98549539 CTGTAGCAGGATAAGGAAATAGG - Intronic
1073174378 10:101543811-101543833 CTGTAGCAACAATAGCATAAAGG - Intronic
1073676746 10:105655782-105655804 CTGCAACAGCAAAAGCAGAATGG + Intergenic
1075747537 10:124738113-124738135 CAGCAGCAGCAAATGCCAATAGG + Intronic
1075948267 10:126456021-126456043 CCCCAGCACCAAAAGCAAATAGG + Intronic
1075957847 10:126539224-126539246 CTTTAGCAGGAAAAGCAAATCGG + Intronic
1079582675 11:22085808-22085830 AAGAAGCACCAAAAGCAAATTGG - Intergenic
1080201557 11:29677418-29677440 CTGTAGTAGCAAAAAAAAAGAGG - Intergenic
1081634829 11:44714152-44714174 CTGGAGCAGAATAAGCAGATGGG + Intergenic
1083049394 11:59763414-59763436 CTGGAGAAGCAAAAGCAGGTAGG + Intronic
1083230330 11:61313569-61313591 CTATAGCAGCAACCACAAATTGG - Exonic
1087255197 11:95945450-95945472 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
1087467961 11:98533660-98533682 ATGTCACAGAAAAAGCAAATTGG + Intergenic
1087505089 11:99010584-99010606 CTGAAGCAGAAAAAGCGATTGGG - Intergenic
1088006277 11:104944846-104944868 CTGTACCTGAAAAAGAAAATAGG + Exonic
1088189702 11:107214902-107214924 CTGAAGAAGAAAGAGCAAATGGG + Intergenic
1089500388 11:118928590-118928612 CTCTATCACCTAAAGCAAATAGG + Intronic
1089663802 11:120003736-120003758 TTTCAGGAGCAAAAGCAAATTGG + Intergenic
1093478852 12:19584023-19584045 CTGTAAAATCAAAAACAAATTGG - Intronic
1096248085 12:50007189-50007211 GTTAAACAGCAAAAGCAAATTGG - Intronic
1096355171 12:50935181-50935203 CAGTACCAACAAAAGCAAAAAGG + Intergenic
1097088446 12:56487073-56487095 CTGTAGCAGGAACAGGAAATGGG - Intronic
1097129094 12:56797008-56797030 CTGTAGTAACATAAACAAATAGG + Intergenic
1097572349 12:61349985-61350007 CTGTGGCAGGAAATGTAAATTGG + Intergenic
1097835303 12:64266805-64266827 CCTTAGCAGCAAAAGCAAGAAGG - Exonic
1098414465 12:70216916-70216938 ATGTAAAAGCAAAAGGAAATGGG + Intergenic
1098628267 12:72699316-72699338 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1098910718 12:76205641-76205663 CTGTAGCAGCAAAGGAGAATAGG + Intergenic
1100205585 12:92345623-92345645 CTGTAACATCAAAAGCAAGCTGG - Intergenic
1100427600 12:94501733-94501755 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1101453856 12:104808921-104808943 CTGAAGCAGCAAAATAAATTTGG + Intronic
1105282462 13:18975798-18975820 CTGCAGAAACAAATGCAAATAGG + Intergenic
1105684838 13:22770670-22770692 CACTGGCAGAAAAAGCAAATGGG + Intergenic
1106718876 13:32418919-32418941 CTGTAAAATCAAAAGCAAGTTGG - Intronic
1107216808 13:37931187-37931209 CTGTATCAGCAAAATGAAAAAGG - Intergenic
1108522059 13:51255505-51255527 TTGTAGCAGCAAAAGCAAAATGG + Intronic
1109684519 13:65798617-65798639 CTATAGCAGAGAAAGCAAAACGG - Intergenic
1109870103 13:68322604-68322626 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1109936519 13:69292931-69292953 CTGTAGAAGCAAAAGAGAAAAGG + Intergenic
1110515255 13:76404192-76404214 GTATAGCAGCATAAGGAAATGGG - Intergenic
1110745885 13:79053101-79053123 CTGTGGCATCCTAAGCAAATTGG - Intergenic
1110940501 13:81342851-81342873 CTGAAGCAACAAAAGGCAATAGG + Intergenic
1111548391 13:89775229-89775251 CTATAGCAGCACTGGCAAATAGG - Intergenic
1111873795 13:93867673-93867695 GTGGAGCAGGAGAAGCAAATAGG - Intronic
1113932514 13:113975795-113975817 CTGGAGCAACAAGGGCAAATGGG + Intergenic
1115604929 14:34991671-34991693 GTGTAGCAGCAATAGCAAGGAGG + Intronic
1115712572 14:36067182-36067204 CTGTGGGGGCAAAAGCAAGTTGG - Intergenic
1115736127 14:36332119-36332141 CTATATCAGCAAAAGAACATAGG + Intergenic
1118046413 14:61975961-61975983 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1120105876 14:80493819-80493841 CTATAGCAGGAGAAGCCAATAGG + Intronic
1120297245 14:82658153-82658175 TTATAGCATGAAAAGCAAATAGG + Intergenic
1122789970 14:104180049-104180071 CTGTAGCACCAAATGCAAAAGGG - Intronic
1125135816 15:36341730-36341752 CTATACCAGCAAAAGCTGATTGG + Intergenic
1125357036 15:38827206-38827228 CTTTGGCAGCAAGAACAAATAGG - Intergenic
1125778402 15:42240227-42240249 ATGTAGCAATAAAAGAAAATTGG - Intronic
1127051115 15:55085129-55085151 CTGTAAAACCAAAAGCAAGTTGG - Intergenic
1127698720 15:61476199-61476221 CTATAGCAGCAATGTCAAATTGG - Intergenic
1129372488 15:75106245-75106267 CTGCAGCAGCAAGAGCAGAATGG + Intronic
1130296552 15:82650426-82650448 CAGAAGCAGCAGAAACAAATAGG + Intergenic
1130541850 15:84826253-84826275 CTGTGGAAGCAGAAGCAAACAGG - Intronic
1131328741 15:91475361-91475383 ATTTAGCTGCAAAAGCAAACAGG + Intergenic
1134317541 16:13133043-13133065 CTGTAGCTAAAAAAGCAAAGAGG + Intronic
1135337626 16:21616829-21616851 CAGTAGCAGAGAAACCAAATAGG - Intronic
1135929921 16:26727809-26727831 CGGTAGCAGCAAAAGCAGTTAGG + Intergenic
1136674693 16:31892576-31892598 CTGTAAAATCAAAAGCAAGTTGG + Intronic
1138371629 16:56531505-56531527 CTGGAGCAGAAAAAGGACATTGG + Intergenic
1140310036 16:73840273-73840295 TTTTAGCAGCAAAAGGACATGGG - Intergenic
1140700546 16:77577535-77577557 TTATAGCAGCAATAGGAAATGGG - Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1144584608 17:16480731-16480753 CTGTAGCAGGAGAAGGAGATGGG - Intronic
1147555144 17:41473919-41473941 CTGTTTCAACAAAAGCAGATAGG + Intergenic
1148993956 17:51691582-51691604 CACAAGCAACAAAAGCAAATGGG - Intronic
1149086786 17:52727501-52727523 CAGTAGCAGCAAAAGTTCATTGG + Intergenic
1150364408 17:64568524-64568546 CTAAAGCAGCAAAAATAAATGGG + Intronic
1156097380 18:33551676-33551698 TTGTATCAGAAAAAGCTAATTGG - Intergenic
1158822726 18:61179519-61179541 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
1161948910 19:7456348-7456370 TTGTAGCAGCAAAAGTACGTCGG - Exonic
1164215234 19:23138913-23138935 CTGTAGGAAAATAAGCAAATAGG + Intronic
1165453531 19:35898533-35898555 CTGTAGAGACAAAAGCAAAAAGG + Intronic
1168635745 19:57995320-57995342 CTGGAGCAGCAAAAACAATGGGG + Intronic
925343257 2:3151219-3151241 CCCTAGCTGCAAAAGCAATTAGG - Intergenic
926249778 2:11147976-11147998 CAGTGCCAGCAAAAGGAAATGGG + Intergenic
927105533 2:19820363-19820385 TCTTAGCAGCAAAGGCAAATAGG - Intergenic
927172707 2:20383657-20383679 CTGAAGTAGCTAAAGCAAAGAGG - Intergenic
929208418 2:39325184-39325206 CTGTAAAAGGGAAAGCAAATGGG - Intronic
929418326 2:41766562-41766584 CAGGAGCAGCAACATCAAATAGG + Intergenic
931533322 2:63242683-63242705 CTGTAAAAGCAAAAGCCATTTGG - Intronic
931719940 2:65060204-65060226 TTGTAGCAGCCAAAGCAAAGAGG + Intronic
931919276 2:66995567-66995589 CTGTTCCAGCAAAAGTATATGGG - Intergenic
935608477 2:104995327-104995349 AGGCAGCAGCAAAAGAAAATGGG + Intergenic
936284421 2:111171349-111171371 CTTTCCCAGAAAAAGCAAATAGG - Intergenic
937800706 2:126077503-126077525 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
937807031 2:126158495-126158517 CTGGGGCAGCCACAGCAAATGGG - Intergenic
939667195 2:144966089-144966111 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
940311382 2:152282619-152282641 CTGGAGTAGAAAAAGCACATGGG - Intergenic
941727329 2:168876421-168876443 ATGTAGTAGCATAAGTAAATAGG + Intronic
942363635 2:175198633-175198655 TGGCAGCAGCAATAGCAAATAGG - Intergenic
942671164 2:178377633-178377655 CTGCAGCTGCCAAAGGAAATTGG + Intronic
943491406 2:188559551-188559573 CTGTAAAATCAAAAGCAAGTGGG - Intronic
944343606 2:198633874-198633896 TTGCAGCAGAAAACGCAAATTGG + Intergenic
946732153 2:222720282-222720304 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
947022270 2:225693132-225693154 CTGGAGCAGGAAAAGAACATTGG - Intergenic
947407010 2:229788869-229788891 AGTTAACAGCAAAAGCAAATAGG - Exonic
947485712 2:230546865-230546887 TTGTAGTAGGAAAAGCAAAGTGG + Intergenic
1169582924 20:7045293-7045315 AAGGAGCAGCAAAAACAAATTGG - Intergenic
1172026101 20:31949861-31949883 CTGTGGCAGTGGAAGCAAATGGG - Intronic
1172611793 20:36257929-36257951 CTGAAGCAGCAAATCCAGATGGG + Intronic
1176066073 20:63196176-63196198 GTCTAGCAGAAAAATCAAATGGG + Exonic
1177881592 21:26701839-26701861 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1178024881 21:28454959-28454981 CTGTTTCTGCAAAAGCCAATAGG + Intergenic
1178790459 21:35694855-35694877 TTGTAACAGCAAAAGCAGAGGGG + Intronic
1179085106 21:38209182-38209204 CTGGAGCAGCAGGAGCAAAGGGG + Intronic
1179353978 21:40641509-40641531 TGGAACCAGCAAAAGCAAATTGG - Intronic
1180987429 22:19913087-19913109 CTGCAGCAGGGAAAGCAAATGGG - Intronic
1182182450 22:28363904-28363926 CTGTAAAATCAAAAGCAAGTTGG - Intronic
1183834459 22:40440777-40440799 CTGTAGGAGCAAATGACAATGGG + Intronic
949944105 3:9176703-9176725 CTGTAAAAGCAGAAGCAAGTGGG + Intronic
951630974 3:24719922-24719944 CTGAAGCAGGAAAGGCAAAAAGG - Intergenic
953363820 3:42324846-42324868 CTGGAGAAGCATAAGCAAGTGGG - Intergenic
953948816 3:47172015-47172037 CTGTAGCAGTATTGGCAAATGGG + Intergenic
954232907 3:49232255-49232277 CAGTAGTGGCAAAAGCAAAAGGG + Intronic
954915669 3:54147037-54147059 CTGATGCAGAAAAGGCAAATTGG - Intronic
954945697 3:54422262-54422284 AGGTAACAGCAATAGCAAATTGG + Intronic
956502131 3:69898340-69898362 CTGGAGGAGCAACAGCAAAGGGG + Intronic
957183511 3:76912107-76912129 CTGAATCAGCATAAGAAAATGGG - Intronic
957192461 3:77027474-77027496 ATATAGCATCAAAAGTAAATTGG + Intronic
957911174 3:86621527-86621549 ATGAAGCAGCAGAAGGAAATAGG + Intergenic
959266945 3:104153945-104153967 CTATATCAACAAAAGCAAAAAGG - Intergenic
964508633 3:157425643-157425665 CTGTAAAATCAAAAGCAAGTTGG - Intronic
967082645 3:186064519-186064541 CTGCAGCAGAAACAGCACATCGG + Intronic
967328278 3:188264409-188264431 CTGTAGCAGTCAAAGGAAACGGG + Intronic
969121833 4:4916588-4916610 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
969288671 4:6224405-6224427 CAGCAGGAGCAAAAGCAAACAGG - Intergenic
969942830 4:10751939-10751961 CTGGAGGTGCAAAAGCAAATGGG + Intergenic
970061615 4:12039980-12040002 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
970223010 4:13829771-13829793 CTGTTACAGCAACAGAAAATGGG + Intergenic
970483099 4:16497539-16497561 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
970721746 4:18996761-18996783 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
971681406 4:29706129-29706151 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
971836432 4:31769423-31769445 ATGTGGCAGAAAAAGAAAATTGG - Intergenic
972093201 4:35314900-35314922 ATCTAGTAGCAAAAGCAACTAGG + Intergenic
972137445 4:35909165-35909187 CTGTAAGATCAAAAGCAAGTTGG - Intergenic
975101642 4:70520946-70520968 CTGTTGCAGAAACAGCAAAATGG + Intronic
978376506 4:108079653-108079675 CTGTTGCAGCAAAAGCTAGATGG + Intronic
978888047 4:113789327-113789349 CTATAGCATTTAAAGCAAATTGG - Intergenic
979473979 4:121133344-121133366 TGGTAACAGAAAAAGCAAATAGG + Intronic
980065002 4:128177417-128177439 CAGTAGCAACAAAAAAAAATAGG - Intronic
981156176 4:141438980-141439002 CTGTAGCAGCAACATCAGACAGG - Intergenic
981236881 4:142427654-142427676 CTGAAGCAGCAGAAGCAATTAGG - Intronic
981391789 4:144199412-144199434 CAATGGCAACAAAAGCAAATGGG + Intergenic
981611350 4:146597128-146597150 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
983249981 4:165332430-165332452 TTGTAGCAGCAAAAACAAAGAGG - Intronic
983718579 4:170816742-170816764 CTATAAAATCAAAAGCAAATTGG - Intergenic
983922688 4:173363686-173363708 CTGTAGTAGCACAAGAAAAAAGG + Intergenic
984061752 4:174997282-174997304 CTGTCAAAGCAAAAGCAGATTGG - Intergenic
984204780 4:176773369-176773391 CTGTAGTGGCTAAAGCAAATTGG - Intronic
985220411 4:187697601-187697623 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
986392666 5:7300591-7300613 CTGAAGCAGAAGAAGCAGATGGG - Intergenic
986543879 5:8874256-8874278 CTGTGGCAGCTACAGCAGATGGG - Intergenic
989416980 5:41190621-41190643 CAGAAGCAACAAAAGCAAATGGG - Intronic
990813278 5:59752958-59752980 CTGTATTTGCAAAAACAAATAGG - Intronic
991184769 5:63794397-63794419 CTGTAAAATCAAAAGCAAACTGG + Intergenic
991536016 5:67669860-67669882 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
993967087 5:94371896-94371918 CTGTAAAATCAAAAGCAAGTTGG + Intronic
994559408 5:101347783-101347805 CAGCTGCAGCAAAAGCAGATGGG - Intergenic
994662212 5:102667618-102667640 CAGTAGCAGCAAAATGAGATTGG + Intergenic
994791844 5:104237187-104237209 AGGTAGCAGCCAAAGCATATAGG + Intergenic
996071578 5:119137320-119137342 CTGTAAAATCAAAAGCAAGTTGG - Intronic
996129548 5:119765124-119765146 ATGTAGGAGAAAAAGCAAAAGGG - Intergenic
996257702 5:121426087-121426109 CTGTAAAATCAAAAGCAACTTGG + Intergenic
996860657 5:128062021-128062043 CTTTAGCAGCCCATGCAAATGGG + Intergenic
1001104157 5:168839049-168839071 CTGTAACATCAAAGGCAATTTGG + Intronic
1001764650 5:174235858-174235880 CTTTAGAAACGAAAGCAAATAGG - Intronic
1003229946 6:4243037-4243059 CTATAAAATCAAAAGCAAATTGG + Intergenic
1003781334 6:9430517-9430539 CTGGAGAAACAAAAGCACATGGG - Intergenic
1005267732 6:24130153-24130175 CTGTAGTAGCAACAACAAAAAGG - Intronic
1005433375 6:25781902-25781924 AAGTAGCTGCAAAAGCATATGGG + Intergenic
1008987022 6:57556757-57556779 CAATTGCAACAAAAGCAAATAGG + Intronic
1011623414 6:89263838-89263860 GTGTAGCTGCAGAAGGAAATTGG - Intronic
1012652583 6:101774801-101774823 ATGTGGCAGTAAAAACAAATAGG + Intronic
1012742992 6:103044108-103044130 CTGAAGCCGCAAAAGAAAACAGG - Intergenic
1013119069 6:107125498-107125520 GTTTAGCAGCAAAAGCACAAAGG + Intergenic
1013574419 6:111467093-111467115 CAGCAGCATCAAAAACAAATAGG - Intronic
1013876247 6:114833273-114833295 TTGTAGCAGCCAAAATAAATTGG + Intergenic
1014861324 6:126470930-126470952 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
1015038483 6:128687030-128687052 CTCTAGGAGCTAAAGCAGATGGG + Intergenic
1015582525 6:134741390-134741412 GTGTGACAGCAAAAGCAGATGGG + Intergenic
1016697560 6:147015809-147015831 GTGTAGCAGCACAAGGACATGGG - Intergenic
1018184446 6:161253905-161253927 CTGTAGCACTGAAAACAAATTGG - Intronic
1021384578 7:20012488-20012510 CTGGAGCAGAGAAAGCAAAATGG + Intergenic
1021603102 7:22384052-22384074 CTGTAGAAGCAAAAGCAGTGAGG + Intergenic
1024594178 7:50918212-50918234 CTGTAGCAGCAGAAGCTAACTGG + Intergenic
1024987114 7:55205095-55205117 CTGTTGCTGCAAAAGAAAGTGGG - Intronic
1027329131 7:77072863-77072885 CTATTGCTGCAAAAGGAAATAGG - Intergenic
1027785466 7:82574237-82574259 CTGTAAAATCAAAAGCAAATTGG + Intergenic
1028660725 7:93269885-93269907 TCCTAGCAGCCAAAGCAAATAGG - Intronic
1029000657 7:97151311-97151333 CTGTAGCTGCAGAAAGAAATAGG + Intronic
1029687042 7:102156219-102156241 CTGTTGCAGCAACAGAAAACAGG - Intronic
1029786636 7:102798504-102798526 CTATTGCTGCAAAAGGAAATAGG + Intronic
1031179282 7:118394205-118394227 CTCTAGCAGAACATGCAAATGGG + Intergenic
1031278700 7:119766892-119766914 CTGTAGCAGTAAAATAAAACAGG - Intergenic
1033837662 7:145335300-145335322 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1033871847 7:145763219-145763241 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
1035974571 8:4293274-4293296 TTGAAGCAGCAAATGAAAATTGG + Intronic
1037008964 8:13817920-13817942 CTGTTACAGCAACAGCAAAATGG - Intergenic
1037219116 8:16495851-16495873 CTTTAGTAGCAAAAGAAAATTGG - Intronic
1037433519 8:18839460-18839482 TTGTGGGAGGAAAAGCAAATGGG - Intronic
1038681922 8:29676603-29676625 CTGTTACAGCACAAGAAAATGGG - Intergenic
1039254801 8:35707240-35707262 CTGAAGCAACATAAGGAAATAGG - Intronic
1040505356 8:48042722-48042744 CTGTAACAGAAACATCAAATAGG + Intronic
1041263050 8:56038281-56038303 CTGTAGCAACAAAATCAATCTGG - Intergenic
1042059061 8:64798235-64798257 CTGGAGCAGCAAATGGAATTCGG + Intronic
1043382604 8:79719685-79719707 CTCTAGCAGAAAAGGCAAGTGGG + Intergenic
1043837008 8:85060073-85060095 CTTTAGCAGCAGAACCACATGGG - Intergenic
1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG + Intergenic
1044826737 8:96205790-96205812 CTGGAGCAGGAAAAGCAAGGAGG - Intergenic
1046703140 8:117423527-117423549 CTGTAAAATCAAAAGCAAGTTGG + Intergenic
1047836914 8:128703804-128703826 CTGCAGCAGCAGCAGCAACTTGG - Intergenic
1048116121 8:131525064-131525086 CTGTAGAATCAAAAGTTAATAGG - Intergenic
1049700367 8:144008488-144008510 CTGACTCAGCAAAAGCAAGTGGG + Intronic
1051057601 9:13006116-13006138 CTGTAGCATAAAAATTAAATAGG - Intergenic
1051250305 9:15152272-15152294 CTGCAGCTCCAAAACCAAATGGG + Intergenic
1053307449 9:36994545-36994567 CTGTGGCAGCTGAAGCTAATGGG - Intronic
1054918093 9:70514331-70514353 CTGTAGCAGGGAAAGCAATTTGG + Intergenic
1055370300 9:75591283-75591305 CAGTAGCAGCAGAACCAACTGGG - Intergenic
1056316446 9:85395116-85395138 ATGTTGCAGCCAAACCAAATGGG - Intergenic
1057365143 9:94413227-94413249 CTGAACCAGAAAAAGAAAATGGG + Intronic
1057658181 9:96974863-96974885 CTGAACCAGAAAAAGAAAATGGG - Intronic
1059215404 9:112556948-112556970 CTGAAGGAACAAAAGCAACTGGG - Intronic
1060284903 9:122241848-122241870 CTGTAGCAGCAAAAGCAAATTGG - Exonic
1185980448 X:4772907-4772929 CTGTAGTAACAAAAGCGAAGAGG + Intergenic
1186233382 X:7480223-7480245 CTGTGGCAGCAAAGGGAAGTTGG + Intergenic
1186421428 X:9430065-9430087 CTGCAGAAGCAAAAGCACACCGG + Intergenic
1189501111 X:41560048-41560070 CTGTATGAGCAAAAGGCAATTGG - Intronic
1190912247 X:54783947-54783969 CTATAGCAACAAAAACAGATTGG + Intronic
1190919009 X:54832596-54832618 CTATAGCAACAAAAACAGATTGG - Intergenic
1191598374 X:62973776-62973798 CTGTAAAATCAAAAGCAACTTGG + Intergenic
1192691803 X:73372853-73372875 CTGTAGCTGCAATGGCAGATGGG + Intergenic
1192732322 X:73813458-73813480 CTTTTGCAGCAAAAGCCAATGGG - Intergenic
1193543130 X:82795480-82795502 CTGTAAAATCAAAAGCAAGTTGG - Intergenic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1194165208 X:90507045-90507067 CTGGAGCTGGAAAAGGAAATTGG + Intergenic
1196791139 X:119466133-119466155 CTGTACCAGAAAAAGGACATTGG - Intergenic
1196897886 X:120355539-120355561 CTGTAGCAACAGAAGCCATTTGG - Intergenic
1197245418 X:124161754-124161776 CTGTAGGTCCAGAAGCAAATAGG + Intronic
1199431405 X:147764491-147764513 CTGTAGCAGAAAAGGGAAAAAGG - Intergenic
1200291099 X:154874745-154874767 CTGTTGCTGCAAAAATAAATTGG + Intronic
1200511471 Y:4084854-4084876 CTGGAGCTGGAAAAGGAAATTGG + Intergenic
1201900535 Y:19043183-19043205 CTGTAGCTGCAAAAGGACAAGGG - Intergenic