ID: 1060289193

View in Genome Browser
Species Human (GRCh38)
Location 9:122284733-122284755
Sequence CAATGTGACAAGAGTGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060289193 Original CRISPR CAATGTGACAAGAGTGTACA AGG (reversed) Intronic
902999705 1:20256363-20256385 CAATGGGACAGGAATGTTCAGGG - Intergenic
906634951 1:47403180-47403202 CAAGGTGTCAAGTGTGTATAGGG - Intergenic
906844896 1:49181232-49181254 CCATGGGAACAGAGTGTACAAGG - Intronic
907090591 1:51721213-51721235 CAAGGTTATAAGAGTATACAAGG + Intronic
907110936 1:51925735-51925757 CAAAGTGCCATGAGAGTACAGGG - Intronic
909004985 1:70265216-70265238 CAAGGTGACAAGAGTGAAGAGGG + Intronic
911412623 1:97529131-97529153 CAGTGGGAGAAGAGTTTACAAGG - Intronic
911860495 1:102941579-102941601 CAATGTCACAGGAATGGACATGG - Intronic
913404153 1:118470267-118470289 CAATGTGACATCACTGAACATGG + Intergenic
915699215 1:157774790-157774812 GAATGGAACAAGAGTGTCCAGGG - Intronic
917271518 1:173280146-173280168 CATTATGAAAAGAGTGTACAGGG - Intergenic
919244450 1:194962619-194962641 CAATGTGGCAAGGGTATTCAAGG - Intergenic
919993029 1:202722121-202722143 CAATATGGCAAGAGGATACATGG + Intergenic
922055738 1:222040851-222040873 CAAAGTGACACGAATGTTCATGG + Intergenic
1063021786 10:2136327-2136349 CAATCTTCCAAGAGTGTAGATGG - Intergenic
1064985506 10:21206405-21206427 CCATGTGACAAGCATGTAAAAGG - Intergenic
1069067511 10:63959213-63959235 CAATGTGACATCATTGAACATGG + Intergenic
1070191014 10:74112159-74112181 CAATGTGTCAAGGCTGCACATGG - Intronic
1071146179 10:82575452-82575474 CAATGTGTGAAGAGTGCACATGG + Intronic
1074433134 10:113410324-113410346 CAATGAGATAAGACTGTACCTGG + Intergenic
1076415792 10:130287511-130287533 GGGTGTGACAAGAGTGTACCTGG + Intergenic
1076431659 10:130408004-130408026 TAATGTGACAAGAGAGTCAAGGG - Intergenic
1077527874 11:3078733-3078755 CAATGTTAGAAGAGTGGACCTGG + Intergenic
1077917041 11:6618198-6618220 CAGTGTGACACTAGTGTGCATGG - Intronic
1078872788 11:15364484-15364506 CCATGTGTCCAGAGTGTAAATGG - Intergenic
1079761518 11:24335332-24335354 CAATGTGACATGAGTGAATGTGG + Intergenic
1085937574 11:81168140-81168162 CCATGTGGCAGGAGTGTACTGGG + Intergenic
1086308480 11:85508338-85508360 CCTTGTGGCAGGAGTGTACATGG - Intronic
1086936753 11:92753598-92753620 CACTGGGAAAACAGTGTACAAGG - Intronic
1088269320 11:108017547-108017569 CAACGTGATAAGAATGTTCAAGG + Intronic
1095247256 12:39937389-39937411 CAATGTTACAATAGTCTACCCGG + Intronic
1098949084 12:76620492-76620514 CATTGTGAAAAGACTGTAAATGG - Intergenic
1099146405 12:79050490-79050512 CAGTGTGATCAGAGTTTACAAGG - Intronic
1099788444 12:87297895-87297917 CAAGGTGATTAGAGTTTACAGGG - Intergenic
1100224351 12:92541031-92541053 CAATGTTCCAAGATTGTGCATGG - Intergenic
1101147408 12:101854249-101854271 AAATGTGCCAAGAGTGCACATGG - Intergenic
1103865428 12:124048031-124048053 GAATGTGCTAAGAGTGTTCAAGG - Intronic
1111208921 13:85050726-85050748 CTATGTGACAACAGTTTGCAGGG - Intergenic
1114441397 14:22751190-22751212 CACTGGCACAAGAGTGTAGACGG - Intergenic
1117715024 14:58571723-58571745 CAATGTGACAAGCATGTATTGGG + Intergenic
1118078050 14:62324091-62324113 CATTCTCACAACAGTGTACAAGG + Intergenic
1119317837 14:73710220-73710242 CAGTGTGTCAAGAGTGTAAGAGG + Intergenic
1120465087 14:84846206-84846228 CAATCTGAACAGAGTTTACAAGG - Intergenic
1124512254 15:30337182-30337204 AGATGTGATAACAGTGTACATGG - Intergenic
1124997028 15:34733566-34733588 CAATGTGAAAACAGTGTATGTGG + Intergenic
1126233755 15:46357791-46357813 CAATGTCCCAAGAGTGAACCAGG + Intergenic
1129414026 15:75364800-75364822 CAGTGTGACAAGAGTGCATGTGG + Intronic
1137714490 16:50590143-50590165 CAAGGTCAAAAGAGTGTTCAGGG - Intronic
1139018253 16:62716274-62716296 CAATGTGACACCTGTGTCCAAGG - Intergenic
1141376379 16:83534516-83534538 CTATGTGAAATGAATGTACATGG + Intronic
1143412395 17:6718174-6718196 CAATCTGACAATAGTGTAGCCGG - Intergenic
1148983388 17:51599115-51599137 CAATGTCCCAAGGCTGTACATGG - Intergenic
1149072723 17:52562137-52562159 TATTGTGACAAGAGTGTTGACGG + Intergenic
1155411507 18:25550449-25550471 CAATGTGAAGAGAGTGAAAATGG - Intergenic
1156889125 18:42169652-42169674 CAATGTGAAAAGAGTGTATCAGG + Intergenic
1157632880 18:49117202-49117224 GAAAGTGACAAGAGTGTCCATGG + Intronic
1158240070 18:55367572-55367594 AAATGTGACAAGAATGTTTATGG - Intronic
1159026822 18:63190736-63190758 CTATGTCACAAGCCTGTACATGG - Intronic
1159962901 18:74569093-74569115 CAACGTTACAAGAGAGGACAAGG + Intronic
1162846611 19:13397600-13397622 CGATGTCACCAGAGCGTACATGG - Intronic
1166348059 19:42179165-42179187 GAAGGTGACAAGAGGGTCCAGGG + Intronic
929394730 2:41509846-41509868 AAATGAGGCAAGAGTGGACAGGG - Intergenic
929821470 2:45277467-45277489 CACAGTGAAAAGTGTGTACAAGG - Intergenic
930305854 2:49673570-49673592 CAAGGGGAGAAGATTGTACAGGG + Intergenic
930315077 2:49787306-49787328 CAATGGGACAGGACTGCACAAGG + Intergenic
931973158 2:67612818-67612840 CAATGTGACCAGATTGCTCAAGG + Intergenic
932988234 2:76754269-76754291 GTATGTGACAAGAATGGACAAGG + Intronic
935514157 2:104014227-104014249 CAATGTGTCAAAATTTTACAGGG + Intergenic
936097756 2:109545998-109546020 CAATGTGACAAGTGTGGGCAGGG + Intronic
938081846 2:128374385-128374407 CAGTGTGACATGTGTTTACACGG - Intergenic
939593466 2:144095301-144095323 CTATGTGCCAAGAATGTTCATGG - Intronic
942894798 2:181039468-181039490 CATTGTCTTAAGAGTGTACAGGG + Intronic
943357358 2:186873588-186873610 AAATGTGAAAAGAGGGTATAGGG - Intergenic
945341831 2:208665445-208665467 TAATGTTACAAAAGTATACAAGG - Intronic
946141662 2:217696261-217696283 CAATGTGAAAGGAGAGTACATGG - Intronic
946703570 2:222436458-222436480 CTAGGTGACAATAGTTTACAGGG - Intronic
1168882050 20:1215461-1215483 CACTGTGACATGAAGGTACAGGG - Intergenic
1168927043 20:1590265-1590287 CAATGTGGCAAATGTGCACAGGG + Intronic
1172193878 20:33078827-33078849 AAATATGACAAGAATGTAAATGG + Intergenic
1177419293 21:20835410-20835432 AAAGGTGACAAGAGTGTATGGGG - Intergenic
1178635906 21:34303023-34303045 CAATTTGACCAGAGTATAAAAGG + Intergenic
1182792669 22:32966093-32966115 CAATGAGCCCAGAGTCTACAGGG + Intronic
950086491 3:10261983-10262005 AAATGTGATCAGAGTATACAAGG - Intronic
951370692 3:21843342-21843364 CAATGTGACATTAGTGGACCAGG + Intronic
952941747 3:38450852-38450874 CAATGTTGCAGTAGTGTACATGG + Intergenic
953208710 3:40855200-40855222 GAATGTGAGCAGAGTGGACAGGG + Intergenic
955685273 3:61543139-61543161 CATTGTGAACAGAGTGTACAAGG - Intergenic
956013704 3:64858814-64858836 AGATGTGATAAGAGTGAACAGGG - Intergenic
956476471 3:69626102-69626124 GAATGTGACAAGGATGTCCATGG + Intergenic
964533724 3:157696510-157696532 CAAGGTGACTAGAGTGGATATGG - Intergenic
964538620 3:157754773-157754795 CCATGTCACAAGTGTTTACATGG - Intergenic
965765239 3:172123689-172123711 CAAGGTGATAAGAGTTTAAATGG - Intronic
968182904 3:196610328-196610350 CAAGGTGACAAACATGTACATGG + Intergenic
969971921 4:11056667-11056689 AAATGTGACAAGAATGAAGAAGG + Intergenic
974138980 4:57859246-57859268 AAATGTGTCAAGAGTGTCTAGGG - Intergenic
975147065 4:70980152-70980174 CAGTGTGAGGAGTGTGTACAGGG - Intronic
979442398 4:120766853-120766875 GAATGTGGCAAGTGTGCACAAGG - Intronic
979881519 4:125964975-125964997 TAATGTGACAAGAATACACAAGG - Intergenic
981220174 4:142222482-142222504 AAATGGGACAAAAGTGTAGAGGG - Intronic
984057397 4:174946956-174946978 CAATGTCACAAGACTGAACCAGG - Intronic
986252609 5:6074438-6074460 CAATGTGGCCATAGTGTTCATGG - Intergenic
987568708 5:19627097-19627119 CAAGGTGACACGATTGAACATGG - Intronic
996149478 5:120018037-120018059 GAAGGTGACAAGAGTATCCAAGG - Intergenic
999388667 5:151174146-151174168 CACAGTGACAACAGTTTACAGGG + Intergenic
1000059595 5:157641933-157641955 TAATGTGATAAAAGTGTACTGGG + Intronic
1003716190 6:8649036-8649058 CACTCTGACAACTGTGTACAAGG - Intergenic
1005359887 6:25021826-25021848 AAATGTGACAAGACTGTGGAGGG + Intronic
1009886244 6:69627407-69627429 CAATATCAGAAGAGTGAACAGGG + Intergenic
1010975780 6:82312345-82312367 CAATGCTACAACAATGTACAAGG + Intergenic
1011126856 6:84017011-84017033 CCATGTGCCAAGTGTGTACTTGG - Intergenic
1012312340 6:97741181-97741203 CAATGGGACAACAGGATACAAGG - Intergenic
1012637772 6:101567276-101567298 CAATATGACAAGAGAGATCATGG - Intronic
1016149394 6:140720926-140720948 CAATGTAAAAAGAGTGTATCAGG - Intergenic
1016448129 6:144153669-144153691 CAATATGACAACAGTTTCCACGG - Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1020600075 7:10263482-10263504 CAATGTGACTTGAGTCAACATGG + Intergenic
1023261798 7:38365703-38365725 GAATAGGAAAAGAGTGTACAAGG + Intergenic
1024292744 7:47816909-47816931 CAATGTGACATCACTGAACATGG - Intronic
1025474370 7:60901014-60901036 CACTGTGACAATAATGAACAGGG - Intergenic
1025488390 7:61080678-61080700 CACTGTGACAATAATGAACAGGG + Intergenic
1025512633 7:61588860-61588882 CACTGTGACAATAATGAACAGGG + Intergenic
1025985056 7:66442739-66442761 CAATGTGACCAGAATTTGCATGG + Intergenic
1026029864 7:66781758-66781780 CAATGTGACCAGAATTTGCATGG - Intronic
1026856850 7:73760853-73760875 CAAGGTGACAATAGGCTACATGG + Intergenic
1027700231 7:81460483-81460505 CAATGTGGCTAGAATTTACAGGG + Intergenic
1027971334 7:85085627-85085649 CAGAGTGACAAGAGAGTACACGG + Intronic
1028124188 7:87092813-87092835 GACTGTTACAAGAATGTACAGGG + Intergenic
1029107574 7:98191076-98191098 CAATATGAAAAGAATTTACAAGG - Intronic
1029306022 7:99620608-99620630 CAGGGTGACGAGAGTGTGCACGG - Intronic
1030576986 7:111300454-111300476 CAATGTGGCTAGAGAGTACATGG - Intronic
1035646408 8:1224935-1224957 CAAAGTGACAAGAGTTAGCAAGG + Intergenic
1037466044 8:19161700-19161722 CCATGTCACAAGTGTCTACAGGG + Intergenic
1038452186 8:27646820-27646842 CAATCTGCCAACAGTTTACAAGG - Intronic
1038976335 8:32700875-32700897 CAGTGTGACAAGGGTCTAAAGGG - Intronic
1042102163 8:65285120-65285142 CCCTGTGACCAGAGAGTACAGGG - Intergenic
1042781397 8:72494872-72494894 TATTGTGACAAGAGTGTCCAAGG - Intergenic
1046128472 8:109940105-109940127 CTAGGTGACAACAGTCTACAGGG - Intergenic
1046617643 8:116495080-116495102 CAGTGGGAGAAGAGGGTACAAGG - Intergenic
1047822148 8:128532836-128532858 CAATGATAGAAGAGTTTACAAGG + Intergenic
1051566293 9:18502746-18502768 CAATATGACAAGAGGCTGCAAGG + Intronic
1052694379 9:31857272-31857294 CAATGTCCCAAGATTGAACAAGG + Intergenic
1055084339 9:72299060-72299082 AAATATGTCAAGAGAGTACAAGG + Intergenic
1055614490 9:78056804-78056826 CAATGAGACAAAGGTTTACAAGG + Intergenic
1055782473 9:79834255-79834277 CAATGTAACAAGAGTGGCCTTGG + Intergenic
1059155347 9:111984216-111984238 CAATGTGGCAGGAATGTACAAGG - Intergenic
1059307334 9:113364391-113364413 AAGTGTGAAAAGATTGTACAAGG - Intronic
1059955849 9:119515292-119515314 CAAGGTGGCAAGAGTGTATAAGG + Intronic
1060289193 9:122284733-122284755 CAATGTGACAAGAGTGTACAAGG - Intronic
1187116590 X:16358566-16358588 TAAGGTGACAAGAATATACATGG - Intergenic
1193424504 X:81326013-81326035 AAATGGGACAACAGTCTACATGG + Intergenic
1195590033 X:106613580-106613602 CATTGTGACAACATTGTAAAAGG - Intronic
1195676443 X:107510773-107510795 CAAGGTGACATGAGTTTACCAGG + Intergenic
1196138388 X:112234309-112234331 CAAGGGGATAAGAGTGTATAAGG - Intergenic
1196763727 X:119223995-119224017 CAAAGTTACAAAAGTGTCCATGG + Intergenic
1197408808 X:126090301-126090323 CTATATGTCAAGAGTGAACATGG + Intergenic
1199340531 X:146671817-146671839 CAACGGGGCAAGAGAGTACAAGG - Intergenic
1199880009 X:151966586-151966608 CAAGGAGACAAGAATGTACTGGG + Intronic
1200007042 X:153093653-153093675 GAATGTGACAAGTGTATACCAGG - Intergenic