ID: 1060296538

View in Genome Browser
Species Human (GRCh38)
Location 9:122347169-122347191
Sequence GCACGGGGCCGCGCTTCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060296538_1060296549 17 Left 1060296538 9:122347169-122347191 CCGGGGGAAGCGCGGCCCCGTGC No data
Right 1060296549 9:122347209-122347231 CCACTCCCGGCTCCGCCCCTCGG No data
1060296538_1060296552 25 Left 1060296538 9:122347169-122347191 CCGGGGGAAGCGCGGCCCCGTGC No data
Right 1060296552 9:122347217-122347239 GGCTCCGCCCCTCGGCTTTGAGG No data
1060296538_1060296544 4 Left 1060296538 9:122347169-122347191 CCGGGGGAAGCGCGGCCCCGTGC No data
Right 1060296544 9:122347196-122347218 CTGACCCCGGCGTCCACTCCCGG No data
1060296538_1060296539 -9 Left 1060296538 9:122347169-122347191 CCGGGGGAAGCGCGGCCCCGTGC No data
Right 1060296539 9:122347183-122347205 GCCCCGTGCTCCGCTGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060296538 Original CRISPR GCACGGGGCCGCGCTTCCCC CGG (reversed) Intergenic