ID: 1060297255

View in Genome Browser
Species Human (GRCh38)
Location 9:122351137-122351159
Sequence GCCGCGTCATTGTCCTCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060297253_1060297255 -7 Left 1060297253 9:122351121-122351143 CCACGACTCGGGTCCAGCCGCGT No data
Right 1060297255 9:122351137-122351159 GCCGCGTCATTGTCCTCACCTGG No data
1060297250_1060297255 14 Left 1060297250 9:122351100-122351122 CCATGCTCTCTATTCTCAAGACC No data
Right 1060297255 9:122351137-122351159 GCCGCGTCATTGTCCTCACCTGG No data
1060297249_1060297255 15 Left 1060297249 9:122351099-122351121 CCCATGCTCTCTATTCTCAAGAC No data
Right 1060297255 9:122351137-122351159 GCCGCGTCATTGTCCTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060297255 Original CRISPR GCCGCGTCATTGTCCTCACC TGG Intergenic
No off target data available for this crispr