ID: 1060299686

View in Genome Browser
Species Human (GRCh38)
Location 9:122368028-122368050
Sequence TGGAGAGGTCTCACTCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060299686_1060299695 18 Left 1060299686 9:122368028-122368050 CCAGCAGGAGTGAGACCTCTCCA No data
Right 1060299695 9:122368069-122368091 CTGTAGCTAGGGTGAGCAGGAGG No data
1060299686_1060299689 -5 Left 1060299686 9:122368028-122368050 CCAGCAGGAGTGAGACCTCTCCA No data
Right 1060299689 9:122368046-122368068 CTCCAGGAGCATTACAATCCAGG No data
1060299686_1060299697 30 Left 1060299686 9:122368028-122368050 CCAGCAGGAGTGAGACCTCTCCA No data
Right 1060299697 9:122368081-122368103 TGAGCAGGAGGGCACGTGATTGG No data
1060299686_1060299692 7 Left 1060299686 9:122368028-122368050 CCAGCAGGAGTGAGACCTCTCCA No data
Right 1060299692 9:122368058-122368080 TACAATCCAGGCTGTAGCTAGGG No data
1060299686_1060299694 15 Left 1060299686 9:122368028-122368050 CCAGCAGGAGTGAGACCTCTCCA No data
Right 1060299694 9:122368066-122368088 AGGCTGTAGCTAGGGTGAGCAGG No data
1060299686_1060299696 19 Left 1060299686 9:122368028-122368050 CCAGCAGGAGTGAGACCTCTCCA No data
Right 1060299696 9:122368070-122368092 TGTAGCTAGGGTGAGCAGGAGGG No data
1060299686_1060299691 6 Left 1060299686 9:122368028-122368050 CCAGCAGGAGTGAGACCTCTCCA No data
Right 1060299691 9:122368057-122368079 TTACAATCCAGGCTGTAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060299686 Original CRISPR TGGAGAGGTCTCACTCCTGC TGG (reversed) Intergenic
No off target data available for this crispr