ID: 1060299688

View in Genome Browser
Species Human (GRCh38)
Location 9:122368043-122368065
Sequence GGATTGTAATGCTCCTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060299688_1060299691 -9 Left 1060299688 9:122368043-122368065 CCTCTCCAGGAGCATTACAATCC No data
Right 1060299691 9:122368057-122368079 TTACAATCCAGGCTGTAGCTAGG No data
1060299688_1060299699 27 Left 1060299688 9:122368043-122368065 CCTCTCCAGGAGCATTACAATCC No data
Right 1060299699 9:122368093-122368115 CACGTGATTGGTGTGGATAATGG No data
1060299688_1060299701 29 Left 1060299688 9:122368043-122368065 CCTCTCCAGGAGCATTACAATCC No data
Right 1060299701 9:122368095-122368117 CGTGATTGGTGTGGATAATGGGG No data
1060299688_1060299692 -8 Left 1060299688 9:122368043-122368065 CCTCTCCAGGAGCATTACAATCC No data
Right 1060299692 9:122368058-122368080 TACAATCCAGGCTGTAGCTAGGG No data
1060299688_1060299696 4 Left 1060299688 9:122368043-122368065 CCTCTCCAGGAGCATTACAATCC No data
Right 1060299696 9:122368070-122368092 TGTAGCTAGGGTGAGCAGGAGGG No data
1060299688_1060299695 3 Left 1060299688 9:122368043-122368065 CCTCTCCAGGAGCATTACAATCC No data
Right 1060299695 9:122368069-122368091 CTGTAGCTAGGGTGAGCAGGAGG No data
1060299688_1060299700 28 Left 1060299688 9:122368043-122368065 CCTCTCCAGGAGCATTACAATCC No data
Right 1060299700 9:122368094-122368116 ACGTGATTGGTGTGGATAATGGG No data
1060299688_1060299698 20 Left 1060299688 9:122368043-122368065 CCTCTCCAGGAGCATTACAATCC No data
Right 1060299698 9:122368086-122368108 AGGAGGGCACGTGATTGGTGTGG No data
1060299688_1060299694 0 Left 1060299688 9:122368043-122368065 CCTCTCCAGGAGCATTACAATCC No data
Right 1060299694 9:122368066-122368088 AGGCTGTAGCTAGGGTGAGCAGG No data
1060299688_1060299697 15 Left 1060299688 9:122368043-122368065 CCTCTCCAGGAGCATTACAATCC No data
Right 1060299697 9:122368081-122368103 TGAGCAGGAGGGCACGTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060299688 Original CRISPR GGATTGTAATGCTCCTGGAG AGG (reversed) Intergenic
No off target data available for this crispr