ID: 1060299693

View in Genome Browser
Species Human (GRCh38)
Location 9:122368064-122368086
Sequence TGCTCACCCTAGCTACAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060299693_1060299699 6 Left 1060299693 9:122368064-122368086 CCAGGCTGTAGCTAGGGTGAGCA No data
Right 1060299699 9:122368093-122368115 CACGTGATTGGTGTGGATAATGG No data
1060299693_1060299698 -1 Left 1060299693 9:122368064-122368086 CCAGGCTGTAGCTAGGGTGAGCA No data
Right 1060299698 9:122368086-122368108 AGGAGGGCACGTGATTGGTGTGG No data
1060299693_1060299704 13 Left 1060299693 9:122368064-122368086 CCAGGCTGTAGCTAGGGTGAGCA No data
Right 1060299704 9:122368100-122368122 TTGGTGTGGATAATGGGGAGGGG No data
1060299693_1060299705 14 Left 1060299693 9:122368064-122368086 CCAGGCTGTAGCTAGGGTGAGCA No data
Right 1060299705 9:122368101-122368123 TGGTGTGGATAATGGGGAGGGGG No data
1060299693_1060299700 7 Left 1060299693 9:122368064-122368086 CCAGGCTGTAGCTAGGGTGAGCA No data
Right 1060299700 9:122368094-122368116 ACGTGATTGGTGTGGATAATGGG No data
1060299693_1060299697 -6 Left 1060299693 9:122368064-122368086 CCAGGCTGTAGCTAGGGTGAGCA No data
Right 1060299697 9:122368081-122368103 TGAGCAGGAGGGCACGTGATTGG No data
1060299693_1060299701 8 Left 1060299693 9:122368064-122368086 CCAGGCTGTAGCTAGGGTGAGCA No data
Right 1060299701 9:122368095-122368117 CGTGATTGGTGTGGATAATGGGG No data
1060299693_1060299703 12 Left 1060299693 9:122368064-122368086 CCAGGCTGTAGCTAGGGTGAGCA No data
Right 1060299703 9:122368099-122368121 ATTGGTGTGGATAATGGGGAGGG No data
1060299693_1060299702 11 Left 1060299693 9:122368064-122368086 CCAGGCTGTAGCTAGGGTGAGCA No data
Right 1060299702 9:122368098-122368120 GATTGGTGTGGATAATGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060299693 Original CRISPR TGCTCACCCTAGCTACAGCC TGG (reversed) Intergenic
No off target data available for this crispr