ID: 1060299695

View in Genome Browser
Species Human (GRCh38)
Location 9:122368069-122368091
Sequence CTGTAGCTAGGGTGAGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060299690_1060299695 -2 Left 1060299690 9:122368048-122368070 CCAGGAGCATTACAATCCAGGCT No data
Right 1060299695 9:122368069-122368091 CTGTAGCTAGGGTGAGCAGGAGG No data
1060299688_1060299695 3 Left 1060299688 9:122368043-122368065 CCTCTCCAGGAGCATTACAATCC No data
Right 1060299695 9:122368069-122368091 CTGTAGCTAGGGTGAGCAGGAGG No data
1060299685_1060299695 19 Left 1060299685 9:122368027-122368049 CCCAGCAGGAGTGAGACCTCTCC No data
Right 1060299695 9:122368069-122368091 CTGTAGCTAGGGTGAGCAGGAGG No data
1060299686_1060299695 18 Left 1060299686 9:122368028-122368050 CCAGCAGGAGTGAGACCTCTCCA No data
Right 1060299695 9:122368069-122368091 CTGTAGCTAGGGTGAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060299695 Original CRISPR CTGTAGCTAGGGTGAGCAGG AGG Intergenic
No off target data available for this crispr