ID: 1060299699

View in Genome Browser
Species Human (GRCh38)
Location 9:122368093-122368115
Sequence CACGTGATTGGTGTGGATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060299688_1060299699 27 Left 1060299688 9:122368043-122368065 CCTCTCCAGGAGCATTACAATCC No data
Right 1060299699 9:122368093-122368115 CACGTGATTGGTGTGGATAATGG No data
1060299690_1060299699 22 Left 1060299690 9:122368048-122368070 CCAGGAGCATTACAATCCAGGCT No data
Right 1060299699 9:122368093-122368115 CACGTGATTGGTGTGGATAATGG No data
1060299693_1060299699 6 Left 1060299693 9:122368064-122368086 CCAGGCTGTAGCTAGGGTGAGCA No data
Right 1060299699 9:122368093-122368115 CACGTGATTGGTGTGGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060299699 Original CRISPR CACGTGATTGGTGTGGATAA TGG Intergenic
No off target data available for this crispr