ID: 1060302654

View in Genome Browser
Species Human (GRCh38)
Location 9:122384333-122384355
Sequence CTGGTGACTCAGAGCGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060302654_1060302656 0 Left 1060302654 9:122384333-122384355 CCATGTTCGCTCTGAGTCACCAG 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1060302656 9:122384356-122384378 TAACTCCCTTCCCCCACCTCTGG No data
1060302654_1060302667 19 Left 1060302654 9:122384333-122384355 CCATGTTCGCTCTGAGTCACCAG 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1060302667 9:122384375-122384397 CTGGCACCACTGGGCATGGCTGG No data
1060302654_1060302659 9 Left 1060302654 9:122384333-122384355 CCATGTTCGCTCTGAGTCACCAG 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1060302659 9:122384365-122384387 TCCCCCACCTCTGGCACCACTGG No data
1060302654_1060302665 15 Left 1060302654 9:122384333-122384355 CCATGTTCGCTCTGAGTCACCAG 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1060302665 9:122384371-122384393 ACCTCTGGCACCACTGGGCATGG No data
1060302654_1060302661 10 Left 1060302654 9:122384333-122384355 CCATGTTCGCTCTGAGTCACCAG 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1060302661 9:122384366-122384388 CCCCCACCTCTGGCACCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060302654 Original CRISPR CTGGTGACTCAGAGCGAACA TGG (reversed) Intronic
900300464 1:1974333-1974355 TGGGTGACTCAGAGCGGAGATGG - Intronic
900437368 1:2637565-2637587 CTGGTGCCTCACAGCCAGCATGG - Intronic
902215075 1:14929653-14929675 TTAGTGACTCACAGCAAACACGG - Intronic
903065163 1:20695616-20695638 CTGGTAAGTCACAGAGAACAGGG + Intronic
903179171 1:21596945-21596967 CTCTGGACTCAGAGGGAACAAGG - Intronic
906569037 1:46820655-46820677 CTGGCCACTCCGAGTGAACAGGG - Intergenic
910475251 1:87598904-87598926 CTGGTGTCTCAGAATGAACTTGG - Intergenic
912006662 1:104911486-104911508 CTGGTGACCAAGAGTGACCAAGG + Intergenic
914213731 1:145605932-145605954 CTGGGGACTCAGAGCCCAGATGG + Intergenic
914465674 1:147926337-147926359 CTGGGGACTCAGAGCCCAGATGG + Intergenic
917478144 1:175386389-175386411 CTGGTGAGTCAGAGAGAGGATGG + Intronic
917856040 1:179100838-179100860 CTGCTCCCTCAGAGTGAACAGGG + Exonic
918554942 1:185787494-185787516 CTGTTGTCTGAGAGCTAACAGGG + Intronic
921784335 1:219210338-219210360 GTGGTGACATAGAGGGAACAGGG + Intronic
922719901 1:227895014-227895036 CTGGTGACTCAGGGTTAGCATGG + Intergenic
922898529 1:229118997-229119019 CTGGGGACCCAGAGCTCACAAGG + Intergenic
924626806 1:245702414-245702436 ATGGAGACGCAGAGCAAACAGGG - Intronic
1063056364 10:2509202-2509224 CTGCTGACTCAGAGGGTCCAGGG + Intergenic
1063459197 10:6204467-6204489 CCGGTGATTCAGACCGAGCAGGG - Intronic
1069169190 10:65203945-65203967 TCCGTGACTCAGAGCAAACAAGG - Intergenic
1069751545 10:70748407-70748429 CTGGGGACTGAGAGCGATCAGGG + Intronic
1075804722 10:125178242-125178264 CTGGTGTCTCAGACTGAAGAGGG + Intergenic
1077865470 11:6218034-6218056 CTGGAGACTCAGAGCCACCCAGG + Exonic
1078560198 11:12364533-12364555 CTAGAGTCTCAGAGGGAACATGG - Intergenic
1080110914 11:28566839-28566861 CGGGTGACTCAGAGCGCAGGAGG + Intergenic
1089440668 11:118514105-118514127 CTGGAGACTCTGAGGGTACAAGG - Intronic
1090188332 11:124752254-124752276 CTGGTATCTCAGAGCAAACAGGG + Intergenic
1092093817 12:5825338-5825360 ATGGTGATTCAGAGCATACATGG - Intronic
1093428158 12:19052683-19052705 CTGGTTACTCAGATAGCACATGG + Intergenic
1097077192 12:56403785-56403807 ATGCTGATTCAGAGCGTACATGG - Intergenic
1097083381 12:56449446-56449468 CACGTGACTCCGAGCGAACTGGG + Intergenic
1097307151 12:58081754-58081776 CTGGTGACACAGAGGTAACAAGG + Intergenic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103272071 12:119681708-119681730 CTTGTGGCTCTGAGCGGACAGGG + Intergenic
1106435954 13:29722815-29722837 CCTGTGACTCTGAGCGGACAAGG - Intergenic
1106722845 13:32453808-32453830 CTGGTGACTCTGAGCTCAAAGGG + Intronic
1107064306 13:36195996-36196018 GTGGTGACACAGAGGGAATAGGG + Intronic
1108518918 13:51227255-51227277 ATGGAGACTCAGAGGGCACATGG + Intronic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1115324657 14:32126304-32126326 CTAGAGTCTCAGAGGGAACATGG - Intronic
1118904251 14:70011972-70011994 CTGGTGACACAGGACGACCATGG + Intronic
1118950567 14:70433189-70433211 ATGCTGACTCAGAGCATACACGG + Intergenic
1128173675 15:65534351-65534373 CTAGTGACTATGAGAGAACACGG + Intronic
1132154371 15:99485403-99485425 CTGGGGACTCAGAGTGTCCATGG + Intergenic
1140980989 16:80109144-80109166 ATTGTGACTGAGAGCCAACATGG + Intergenic
1203143854 16_KI270728v1_random:1786654-1786676 CTGGTGACTCCGAGGGACCCGGG - Intergenic
1143739995 17:8945459-8945481 CTGGTGACCCAGAGAGAGCCTGG + Intronic
1144413752 17:15025817-15025839 CGGGTGACTCAAAGCAAAGAGGG - Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1156972659 18:43175506-43175528 CTGTTGAGACACAGCGAACAAGG + Intergenic
1157465302 18:47938882-47938904 CTGGTGCCTCAAAGACAACATGG - Intergenic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1165318045 19:35068645-35068667 CTGGGGACTCTGAGAGAACATGG + Intergenic
1166972371 19:46577838-46577860 ATGGTGACTCAGAGCTCCCAAGG + Intronic
1167874533 19:52400467-52400489 CTGGTGACTCAGATAAAAAAAGG - Intronic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
928443323 2:31311698-31311720 CAGGAGACTCAGAGCCCACAGGG + Intergenic
930404685 2:50940535-50940557 CTTGTGACCCAGAGAGCACAAGG - Intronic
930435917 2:51341922-51341944 CTGGTGACTCAGTCTTAACATGG - Intergenic
934796930 2:97109274-97109296 CTGGTGACTCAAAGAGAGAAAGG - Intergenic
934836483 2:97594157-97594179 CTGGTGACTCAAAGAGAGAAAGG + Intergenic
936545321 2:113387303-113387325 CTGGTGACTCAAAGAGAGAAAGG - Intergenic
939788491 2:146544732-146544754 ATGCTGACTCAGAGCATACATGG + Intergenic
939806427 2:146779856-146779878 ATGCTGATTCAGAGCGTACATGG - Intergenic
1169891857 20:10461973-10461995 ATGGAGTCTCAGAGCGAAAAAGG + Intronic
1178399556 21:32273522-32273544 CTGGGGACTAAGACCAAACATGG + Intronic
1178701713 21:34839454-34839476 CTGTGAACTCAAAGCGAACAGGG + Intronic
1181137213 22:20776630-20776652 CTGGTACTCCAGAGCGAACAAGG + Intronic
1181317403 22:21979468-21979490 CTGGGGACTCAGAGTCCACATGG - Intronic
1183810760 22:40255217-40255239 ATGGTGAGTCAAAGCCAACAGGG + Intronic
1184739037 22:46416464-46416486 CTGGTCACTCAGGCCGAGCAAGG + Intronic
949445801 3:4132451-4132473 ATGGTGATTCAGAGCATACATGG - Intronic
955112127 3:55959704-55959726 CTGGTGAGCCAGAGAGCACAGGG + Intronic
956743246 3:72291387-72291409 CGGCTGAGTCAGAGCCAACACGG + Intergenic
961064381 3:123862094-123862116 CTGGTGACGCTGAGCCAGCATGG - Intronic
961793410 3:129392700-129392722 CTGGTGACTCAGAGAGGGCATGG + Intergenic
961807407 3:129499318-129499340 CTGGTGACTCAGAGAGGGCATGG + Intronic
966717579 3:183029349-183029371 CTGGTGACTTAAGACGAACATGG + Intronic
971512226 4:27440955-27440977 CAGGTGACTCAGAGGACACATGG + Intergenic
974466059 4:62258087-62258109 CTGGAGACACAGAGAGAAAATGG - Intergenic
977797050 4:101178930-101178952 CTGCTGACTAAGAGTGACCAGGG - Intronic
981723908 4:147828349-147828371 CTGGTGGCTCAAAACCAACAGGG - Intronic
983305465 4:165979544-165979566 CTGGTTACTCTGAGAGAACATGG + Intronic
986064920 5:4225883-4225905 CTAGGGACACAGAGAGAACACGG - Intergenic
992908560 5:81372561-81372583 CTGATGAGGCAGAGCCAACAAGG - Intronic
997864104 5:137445449-137445471 CTGGGCACTCAGAGGCAACAGGG + Intronic
999831508 5:155324630-155324652 ATGGTGACTCAGAGAGATCCTGG - Intergenic
1001040604 5:168332230-168332252 CTGATGACTCAGAGCTGAGAAGG + Intronic
1002900960 6:1409277-1409299 CTGGTGCCTAAGGGCGCACACGG - Intergenic
1003762762 6:9198908-9198930 CTGGTGACTCAGCAAGAAGAGGG - Intergenic
1007461988 6:42025706-42025728 CTTGTGACTCAGAGCCCAAAAGG - Intronic
1007661385 6:43488970-43488992 CTGATGACTCAGGGCAAAAAGGG - Intronic
1009705030 6:67239032-67239054 CAGGGGACTCAGAGGGGACAGGG - Intergenic
1011043546 6:83057380-83057402 CTGGGGATACAGAGTGAACAAGG - Intronic
1015443096 6:133271175-133271197 ATGCTGATTCAGAGCGTACATGG + Intronic
1018663550 6:166112770-166112792 CGGGTGACTCATAGCTTACACGG + Intergenic
1018847949 6:167568070-167568092 CTGGCCACTGAGAGAGAACATGG - Intergenic
1019558349 7:1643576-1643598 CTGGGGACTCAGAGGGAATGGGG + Intergenic
1033813410 7:145044558-145044580 CTGGTTTCTCAGTGCAAACAAGG + Intergenic
1034473209 7:151267410-151267432 ATAGTGACTCAGAAAGAACACGG - Intronic
1034912806 7:155011412-155011434 TTTGTGACTGAGAGGGAACATGG - Intergenic
1034969785 7:155411640-155411662 CTGGAGCCACAGAGCGACCAAGG + Intergenic
1038024023 8:23573232-23573254 CGGGTGACGCAGAGCAGACAAGG - Exonic
1042566505 8:70117235-70117257 CTGGTGACCCAGACCAATCAAGG - Intronic
1049004079 8:139843871-139843893 CTGGTGAATCAGCGTGCACATGG - Intronic
1052352094 9:27468466-27468488 CTGGTAAAGCAGAGGGAACAAGG + Intronic
1054854840 9:69887802-69887824 CTGGTGGCTCAGAGCTTAAAAGG - Intronic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1062194275 9:135264263-135264285 CTGATGACCCACAGAGAACAGGG - Intergenic
1187430080 X:19214580-19214602 CTGATGACTAAGAGCAAGCAGGG - Intergenic
1193833140 X:86311487-86311509 ATGGTGATTCAGAGCATACATGG - Intronic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1197420066 X:126227715-126227737 ATGCTGACTCAGAGCATACAGGG - Intergenic