ID: 1060302661

View in Genome Browser
Species Human (GRCh38)
Location 9:122384366-122384388
Sequence CCCCCACCTCTGGCACCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060302649_1060302661 30 Left 1060302649 9:122384313-122384335 CCCTGACATCCCTGTCCAGACCA 0: 1
1: 0
2: 1
3: 20
4: 257
Right 1060302661 9:122384366-122384388 CCCCCACCTCTGGCACCACTGGG No data
1060302653_1060302661 15 Left 1060302653 9:122384328-122384350 CCAGACCATGTTCGCTCTGAGTC 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1060302661 9:122384366-122384388 CCCCCACCTCTGGCACCACTGGG No data
1060302655_1060302661 -9 Left 1060302655 9:122384352-122384374 CCAGTAACTCCCTTCCCCCACCT 0: 1
1: 0
2: 5
3: 71
4: 507
Right 1060302661 9:122384366-122384388 CCCCCACCTCTGGCACCACTGGG No data
1060302651_1060302661 21 Left 1060302651 9:122384322-122384344 CCCTGTCCAGACCATGTTCGCTC 0: 1
1: 0
2: 0
3: 1
4: 75
Right 1060302661 9:122384366-122384388 CCCCCACCTCTGGCACCACTGGG No data
1060302650_1060302661 29 Left 1060302650 9:122384314-122384336 CCTGACATCCCTGTCCAGACCAT 0: 1
1: 1
2: 1
3: 13
4: 225
Right 1060302661 9:122384366-122384388 CCCCCACCTCTGGCACCACTGGG No data
1060302652_1060302661 20 Left 1060302652 9:122384323-122384345 CCTGTCCAGACCATGTTCGCTCT 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1060302661 9:122384366-122384388 CCCCCACCTCTGGCACCACTGGG No data
1060302654_1060302661 10 Left 1060302654 9:122384333-122384355 CCATGTTCGCTCTGAGTCACCAG 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1060302661 9:122384366-122384388 CCCCCACCTCTGGCACCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060302661 Original CRISPR CCCCCACCTCTGGCACCACT GGG Intronic
No off target data available for this crispr