ID: 1060302665

View in Genome Browser
Species Human (GRCh38)
Location 9:122384371-122384393
Sequence ACCTCTGGCACCACTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060302652_1060302665 25 Left 1060302652 9:122384323-122384345 CCTGTCCAGACCATGTTCGCTCT 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1060302665 9:122384371-122384393 ACCTCTGGCACCACTGGGCATGG No data
1060302653_1060302665 20 Left 1060302653 9:122384328-122384350 CCAGACCATGTTCGCTCTGAGTC 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1060302665 9:122384371-122384393 ACCTCTGGCACCACTGGGCATGG No data
1060302655_1060302665 -4 Left 1060302655 9:122384352-122384374 CCAGTAACTCCCTTCCCCCACCT 0: 1
1: 0
2: 5
3: 71
4: 507
Right 1060302665 9:122384371-122384393 ACCTCTGGCACCACTGGGCATGG No data
1060302651_1060302665 26 Left 1060302651 9:122384322-122384344 CCCTGTCCAGACCATGTTCGCTC 0: 1
1: 0
2: 0
3: 1
4: 75
Right 1060302665 9:122384371-122384393 ACCTCTGGCACCACTGGGCATGG No data
1060302654_1060302665 15 Left 1060302654 9:122384333-122384355 CCATGTTCGCTCTGAGTCACCAG 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1060302665 9:122384371-122384393 ACCTCTGGCACCACTGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060302665 Original CRISPR ACCTCTGGCACCACTGGGCA TGG Intronic
No off target data available for this crispr