ID: 1060304380

View in Genome Browser
Species Human (GRCh38)
Location 9:122397773-122397795
Sequence AGGGAGAGTGTAGTGGTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060304370_1060304380 20 Left 1060304370 9:122397730-122397752 CCCCGATCCCTGGCAGCAGCCAC No data
Right 1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG No data
1060304375_1060304380 12 Left 1060304375 9:122397738-122397760 CCTGGCAGCAGCCACATGGCACA No data
Right 1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG No data
1060304368_1060304380 24 Left 1060304368 9:122397726-122397748 CCCTCCCCGATCCCTGGCAGCAG No data
Right 1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG No data
1060304367_1060304380 28 Left 1060304367 9:122397722-122397744 CCATCCCTCCCCGATCCCTGGCA No data
Right 1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG No data
1060304371_1060304380 19 Left 1060304371 9:122397731-122397753 CCCGATCCCTGGCAGCAGCCACA No data
Right 1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG No data
1060304374_1060304380 13 Left 1060304374 9:122397737-122397759 CCCTGGCAGCAGCCACATGGCAC No data
Right 1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG No data
1060304372_1060304380 18 Left 1060304372 9:122397732-122397754 CCGATCCCTGGCAGCAGCCACAT No data
Right 1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG No data
1060304369_1060304380 23 Left 1060304369 9:122397727-122397749 CCTCCCCGATCCCTGGCAGCAGC No data
Right 1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG No data
1060304376_1060304380 1 Left 1060304376 9:122397749-122397771 CCACATGGCACAGAGAATCTGTG No data
Right 1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060304380 Original CRISPR AGGGAGAGTGTAGTGGTTGT AGG Intergenic
No off target data available for this crispr