ID: 1060309724

View in Genome Browser
Species Human (GRCh38)
Location 9:122448490-122448512
Sequence CCCGTGAAGGGTCTGTGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060309724_1060309732 -9 Left 1060309724 9:122448490-122448512 CCTCATCACAGACCCTTCACGGG No data
Right 1060309732 9:122448504-122448526 CTTCACGGGCGTCAGGCTGGGGG No data
1060309724_1060309731 -10 Left 1060309724 9:122448490-122448512 CCTCATCACAGACCCTTCACGGG No data
Right 1060309731 9:122448503-122448525 CCTTCACGGGCGTCAGGCTGGGG No data
1060309724_1060309738 30 Left 1060309724 9:122448490-122448512 CCTCATCACAGACCCTTCACGGG No data
Right 1060309738 9:122448543-122448565 CATCCCAAGAGGCCATATCCAGG No data
1060309724_1060309735 19 Left 1060309724 9:122448490-122448512 CCTCATCACAGACCCTTCACGGG No data
Right 1060309735 9:122448532-122448554 TAGGTCTTTCCCATCCCAAGAGG No data
1060309724_1060309733 -5 Left 1060309724 9:122448490-122448512 CCTCATCACAGACCCTTCACGGG No data
Right 1060309733 9:122448508-122448530 ACGGGCGTCAGGCTGGGGGATGG No data
1060309724_1060309734 0 Left 1060309724 9:122448490-122448512 CCTCATCACAGACCCTTCACGGG No data
Right 1060309734 9:122448513-122448535 CGTCAGGCTGGGGGATGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060309724 Original CRISPR CCCGTGAAGGGTCTGTGATG AGG (reversed) Intergenic
No off target data available for this crispr