ID: 1060319683

View in Genome Browser
Species Human (GRCh38)
Location 9:122545949-122545971
Sequence CAATTCTCAGGACAGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060319683_1060319691 25 Left 1060319683 9:122545949-122545971 CCTCCTCCCTGTCCTGAGAATTG No data
Right 1060319691 9:122545997-122546019 GTCTATATCACCATTATGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060319683 Original CRISPR CAATTCTCAGGACAGGGAGG AGG (reversed) Intergenic
No off target data available for this crispr