ID: 1060342963

View in Genome Browser
Species Human (GRCh38)
Location 9:122792976-122792998
Sequence CCTTGAAGGGAGAGTGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060342963_1060342971 12 Left 1060342963 9:122792976-122792998 CCCTCTACACTCTCCCTTCAAGG No data
Right 1060342971 9:122793011-122793033 CCTGGCGCCACTTAGACTGCAGG No data
1060342963_1060342973 23 Left 1060342963 9:122792976-122792998 CCCTCTACACTCTCCCTTCAAGG No data
Right 1060342973 9:122793022-122793044 TTAGACTGCAGGAAAACTGAAGG No data
1060342963_1060342968 -6 Left 1060342963 9:122792976-122792998 CCCTCTACACTCTCCCTTCAAGG No data
Right 1060342968 9:122792993-122793015 TCAAGGAGAAATCAACCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060342963 Original CRISPR CCTTGAAGGGAGAGTGTAGA GGG (reversed) Intergenic
No off target data available for this crispr