ID: 1060346522

View in Genome Browser
Species Human (GRCh38)
Location 9:122821660-122821682
Sequence TTGCAGATAAATCAGCAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060346517_1060346522 13 Left 1060346517 9:122821624-122821646 CCCTAATTCTGCCAGACAGTTTC 0: 1
1: 0
2: 2
3: 12
4: 182
Right 1060346522 9:122821660-122821682 TTGCAGATAAATCAGCAGGACGG No data
1060346518_1060346522 12 Left 1060346518 9:122821625-122821647 CCTAATTCTGCCAGACAGTTTCC 0: 1
1: 0
2: 0
3: 14
4: 145
Right 1060346522 9:122821660-122821682 TTGCAGATAAATCAGCAGGACGG No data
1060346519_1060346522 2 Left 1060346519 9:122821635-122821657 CCAGACAGTTTCCAATTCTGTTC 0: 1
1: 0
2: 0
3: 22
4: 194
Right 1060346522 9:122821660-122821682 TTGCAGATAAATCAGCAGGACGG No data
1060346520_1060346522 -9 Left 1060346520 9:122821646-122821668 CCAATTCTGTTCTATTGCAGATA 0: 1
1: 0
2: 2
3: 21
4: 337
Right 1060346522 9:122821660-122821682 TTGCAGATAAATCAGCAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060346522 Original CRISPR TTGCAGATAAATCAGCAGGA CGG Intronic
No off target data available for this crispr