ID: 1060355917

View in Genome Browser
Species Human (GRCh38)
Location 9:122906779-122906801
Sequence AGAACGAAAAAGATAATGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060355917_1060355918 3 Left 1060355917 9:122906779-122906801 CCACACATTATCTTTTTCGTTCT No data
Right 1060355918 9:122906805-122906827 CTCTTTATGAAACATATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060355917 Original CRISPR AGAACGAAAAAGATAATGTG TGG (reversed) Intergenic
No off target data available for this crispr