ID: 1060355918

View in Genome Browser
Species Human (GRCh38)
Location 9:122906805-122906827
Sequence CTCTTTATGAAACATATGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060355917_1060355918 3 Left 1060355917 9:122906779-122906801 CCACACATTATCTTTTTCGTTCT No data
Right 1060355918 9:122906805-122906827 CTCTTTATGAAACATATGCCAGG No data
1060355916_1060355918 23 Left 1060355916 9:122906759-122906781 CCACATCGAAGACGTTTCTTCCA No data
Right 1060355918 9:122906805-122906827 CTCTTTATGAAACATATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060355918 Original CRISPR CTCTTTATGAAACATATGCC AGG Intergenic
No off target data available for this crispr